ID: 936729190

View in Genome Browser
Species Human (GRCh38)
Location 2:115360420-115360442
Sequence TTTCACAGGCAGTGTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936729187_936729190 21 Left 936729187 2:115360376-115360398 CCTCTGTACAGGTTATTTAATTA 0: 1
1: 0
2: 0
3: 15
4: 180
Right 936729190 2:115360420-115360442 TTTCACAGGCAGTGTGTGGAAGG 0: 1
1: 0
2: 2
3: 27
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936729190 Original CRISPR TTTCACAGGCAGTGTGTGGA AGG Intronic
900354591 1:2254184-2254206 CTTCACAATCAGTGTCTGGAGGG - Intronic
901265353 1:7905973-7905995 CTTCACAGCCAGTGGGTGGGTGG + Intergenic
902667851 1:17952166-17952188 TTCCACAGGCAATGTGGGGCTGG + Intergenic
903581418 1:24373606-24373628 CTTCACAGGGAGTCTTTGGAAGG - Intronic
905661447 1:39729179-39729201 ATTCACAGGCAAAGAGTGGAAGG - Intronic
905797753 1:40825064-40825086 TTTCCCATGCTGTGAGTGGACGG - Intronic
906118141 1:43368812-43368834 TTTGGCAGCCAGTGTGAGGAGGG + Intergenic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
906701181 1:47859301-47859323 TTTCCCAGCCAGTGTGAGGCTGG - Intronic
907429402 1:54403448-54403470 TTTTGGAGGGAGTGTGTGGATGG - Intronic
907641096 1:56191176-56191198 ATTCACAGAGAGTTTGTGGAAGG + Intergenic
908248128 1:62243907-62243929 ATTTACAGACAGTGTCTGGAGGG - Intronic
910574743 1:88748371-88748393 TTTCAAAGGCAATATGCGGAGGG - Intronic
910664888 1:89713875-89713897 TTTCAAAAACAGTGTCTGGAAGG - Exonic
911088297 1:93997992-93998014 CTTCCCAGGCAGTGTGCAGAGGG - Exonic
911882191 1:103254073-103254095 TTGCACAGGGAGTGTGGGGAGGG + Intergenic
913123295 1:115761962-115761984 CTGGACAGGCACTGTGTGGATGG + Intronic
915049776 1:153056539-153056561 TTTGACTGGCAGGGTGGGGAAGG + Exonic
916038128 1:160938997-160939019 ATTTAAAGGCAGTGTGTGGAGGG - Intergenic
916696915 1:167247352-167247374 TATCACAGGCTGGGTGTGGCAGG - Intronic
917533308 1:175856089-175856111 TGTGTCAGGCAGTGTGTGAAGGG - Intergenic
918677765 1:187309596-187309618 TTTCACTGTAAGTGTGTGAAGGG + Intergenic
920875767 1:209833919-209833941 TTTCTCAGCCAGTGTCTGGGTGG + Intronic
922154494 1:223030414-223030436 TTTTAAAGGCAGTGTGGGGAAGG + Intergenic
1062780486 10:200711-200733 TTTCAATAGCAGTGTGTTGAGGG + Intronic
1063227062 10:4025566-4025588 TTTAACAGGCTGTTAGTGGAGGG + Intergenic
1063712084 10:8489417-8489439 TCTCATATGCAGTGTGAGGATGG + Intergenic
1065285488 10:24183629-24183651 TTGCTCAGGAATTGTGTGGAAGG - Intronic
1070426831 10:76297064-76297086 TTTCACAGGCAGTGAATCAAGGG - Intronic
1070773977 10:79099343-79099365 TTTCAAAGGCAGCCTGGGGAAGG - Intronic
1071311709 10:84349092-84349114 TTTAAAAAGCAGTCTGTGGAAGG - Intronic
1072425265 10:95324673-95324695 ATCCAGAGGCAGTGAGTGGAGGG - Intronic
1073595337 10:104793968-104793990 TTTAAGAGGCAGAGTGTGGCAGG + Intronic
1074937950 10:118204751-118204773 GTTCACAGCCAGTGTGTGGGAGG - Intergenic
1075017123 10:118918038-118918060 TTTCACCGTCAGTGTATGGGTGG - Intergenic
1075497477 10:122937467-122937489 CTTCCCAGGCATTTTGTGGAAGG - Intronic
1076711355 10:132336884-132336906 TTTTACAGTCACAGTGTGGAAGG - Intronic
1078133857 11:8636266-8636288 TTTCAAAGGCAGTTTGGGGAAGG - Intronic
1079031257 11:16987974-16987996 TTTCTCAGACAGTGTGTGGAAGG + Intronic
1080354571 11:31427475-31427497 TTTCACTGCTGGTGTGTGGAAGG + Intronic
1081527008 11:43934291-43934313 AGTCACAGGCTTTGTGTGGAGGG + Intronic
1081570212 11:44286127-44286149 TGACACAAGCAGTGTGTGCAGGG - Intronic
1082734477 11:56840608-56840630 TTTGACAGTCAGTGTAGGGAGGG - Intergenic
1084101113 11:66950326-66950348 TTCCACTGCCTGTGTGTGGAAGG - Intronic
1085191814 11:74632763-74632785 TCTCTCAGGGAGTGTGTGGAAGG + Intronic
1088444890 11:109915557-109915579 TTTTACAGTCAGTCTATGGAAGG - Intergenic
1088952642 11:114586955-114586977 GTTCACAGGGGGTGTGGGGAGGG - Intronic
1089673300 11:120072176-120072198 TGTCAGAGGCATTGTGGGGAAGG - Intergenic
1091390120 12:121101-121123 TTCGACAGGAAGTATGTGGATGG - Intronic
1091704714 12:2685982-2686004 TTCCAAAGGCAGGGTGTGCAGGG + Intronic
1091711287 12:2742321-2742343 TTCCAAAGGCAGGGTGTGCAGGG + Intergenic
1095598657 12:43989928-43989950 ATTCAAAGGCATTGTATGGAAGG - Intronic
1097120261 12:56726107-56726129 ATTCAAGGGCAGTGTGAGGATGG - Intronic
1098443442 12:70542058-70542080 TCTCATAAGCAGTGTATGGAAGG + Intronic
1100167763 12:91937598-91937620 TTCCAGAGGCAGTGTCTGAAAGG + Intergenic
1100423341 12:94459474-94459496 ATTCAAGGGCAGTTTGTGGAGGG + Intronic
1101976890 12:109367477-109367499 TTTCATACCCAGTTTGTGGAAGG + Intronic
1102050490 12:109858297-109858319 TCTCACAGGCAGTCTATGGCTGG + Intronic
1104546342 12:129716349-129716371 TTTCACAGGCTGTTTGCTGATGG - Intronic
1104559223 12:129828908-129828930 TTTCACAGGCAAGGTGCAGATGG - Intronic
1104886270 12:132110791-132110813 TCCCACAGGAAGAGTGTGGAGGG + Intronic
1107326634 13:39250657-39250679 TTTCACAAGCAGTGTGCCTAAGG - Intergenic
1107826252 13:44331520-44331542 TTCCACAGCCCGTGTGTAGAGGG + Intergenic
1108005786 13:45944921-45944943 TTTCACAAGCAGACTTTGGAGGG - Intergenic
1110247494 13:73342867-73342889 TTCCACAGACAGTGTGTGGGGGG - Intergenic
1110797941 13:79661423-79661445 TTTCACACCCAGGCTGTGGAGGG + Intergenic
1111206187 13:85013848-85013870 TTTCACAGGCTATGGCTGGAGGG + Intergenic
1112033400 13:95476633-95476655 CCTCCCAGGCAGTGTGTGAAGGG + Intronic
1112163698 13:96895524-96895546 TTTCAAAGGCAATTTGGGGAAGG + Intergenic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1113596439 13:111537375-111537397 TTGCAGAGGCAGGGTCTGGAAGG + Intergenic
1113745676 13:112742436-112742458 TGTCACAGGTCGTGTGTGGGGGG + Intronic
1113767021 13:112888059-112888081 TTTCACAGGCAGTGCTCCGAAGG + Intergenic
1115577296 14:34724136-34724158 TTTTGTAGGCAGTTTGTGGAAGG - Intergenic
1116040704 14:39683397-39683419 TTTCAGAGGAAGTCTGTGAATGG + Intergenic
1116278572 14:42870428-42870450 TTTTACACGTTGTGTGTGGAGGG - Intergenic
1117055872 14:51911455-51911477 TTTCCCAGTCAGTAAGTGGAGGG - Intronic
1117189866 14:53278915-53278937 GTCCACAGGGAGTGGGTGGATGG + Intergenic
1118474181 14:66101648-66101670 TTTCAAAGGTAGTTTGGGGATGG - Intergenic
1119140827 14:72265799-72265821 TTGCACAGGCAGCTTGGGGAAGG - Intronic
1120729045 14:87980812-87980834 TTTGTCAGGCATTGTGTGTATGG - Intronic
1120767743 14:88345632-88345654 TTTAACAAGCAGTGGGTGGTTGG + Intergenic
1121794579 14:96724451-96724473 TTCCACAGGCAGAGGGTTGAAGG - Intergenic
1122423325 14:101590876-101590898 AGGCACAGGCGGTGTGTGGACGG + Intergenic
1122450082 14:101798844-101798866 TGTCACAGGAGGTGAGTGGAAGG + Intronic
1123468230 15:20531518-20531540 TTTCACAGGCTGGGTGTGTGGGG - Intergenic
1123649885 15:22469546-22469568 TTTCACAGGCTGGGTGTGTGGGG + Intergenic
1123681246 15:22765738-22765760 TTTGACAGGCTGGGTGTGTAGGG - Intergenic
1123687647 15:22810759-22810781 TTTAACAGACATTGTGTGGTGGG + Exonic
1123728546 15:23126728-23126750 TTTCACAGGCTGGGTGTGTGGGG - Intergenic
1123740288 15:23278365-23278387 TTTCACAGGCTGGGTGTGTGGGG + Intergenic
1123746710 15:23324193-23324215 TTTCACAGGCTGGGTGTGTGGGG - Intergenic
1124099521 15:26680365-26680387 TTTCACTTGCAGTGTTAGGAAGG - Intronic
1124278978 15:28347509-28347531 TTTCACAGGCTGGGTGTGTGGGG - Intergenic
1124303721 15:28564099-28564121 TTTCACAGGCTGGGTGTGTGGGG + Intergenic
1124333456 15:28840200-28840222 TTTGACAGGCTGGGTGTGTAGGG - Intergenic
1124532617 15:30520576-30520598 TTTCACAGGCTGGGTGTGTGGGG + Intergenic
1124649648 15:31465351-31465373 GTCCTCAGGCAGTTTGTGGAAGG + Intergenic
1124766036 15:32487068-32487090 TTTCACAGGCTGGGTGTGTGGGG - Intergenic
1125266675 15:37889418-37889440 TTTCAGAGCCAGGGTGTGGTTGG + Intergenic
1126301134 15:47197327-47197349 TTTCACAGGCAGTGAGTTTAAGG + Intronic
1129315375 15:74739906-74739928 CTTCACAGACAGGGTCTGGAGGG + Intergenic
1129661906 15:77557464-77557486 TGGCACCGGCAGTGTGGGGAGGG - Intergenic
1130662048 15:85838531-85838553 TCTAAAAGCCAGTGTGTGGAGGG - Intergenic
1131296540 15:91154427-91154449 TTAGACAGGCAGATTGTGGAAGG + Intronic
1131330908 15:91498507-91498529 TTTCATTGGCAGTGAGGGGAAGG - Intergenic
1131337084 15:91559488-91559510 TCTCCCTGTCAGTGTGTGGAAGG - Intergenic
1131508489 15:93036026-93036048 TTACACGTGCAGTGTGGGGAGGG - Intronic
1133489295 16:6251393-6251415 TCACACAGTCAGTGTGTGGAGGG + Intronic
1137000454 16:35225258-35225280 CTTCACAGGTAGTGTGAGGAGGG - Intergenic
1137033610 16:35547845-35547867 CTTCACAGGCAATGTGAGGAGGG - Intergenic
1141105358 16:81229023-81229045 TTGCACAGGCACTGTTTGGCAGG - Intergenic
1141259455 16:82439649-82439671 TTTCACAGGCAGGTTGTGGGTGG + Intergenic
1141368719 16:83467751-83467773 TTACACAGCCGGTGTGTGGTGGG - Intronic
1142282286 16:89154834-89154856 TGTCACAGAAAGTGCGTGGACGG + Exonic
1143379059 17:6484439-6484461 TTTCAGAGGCAGGGCCTGGATGG - Intronic
1143591008 17:7885680-7885702 TTGGACAGGCAGAGTGGGGACGG + Intronic
1144654792 17:17028648-17028670 TTGCACAGGCAGTATGTGGTGGG - Intergenic
1144728557 17:17513926-17513948 TTTCACACCCAGTCTGTAGACGG + Intronic
1147740699 17:42669725-42669747 ATTCACAGCACGTGTGTGGAGGG + Intronic
1147959973 17:44161409-44161431 TTACACAGGCACTTTGAGGAAGG + Intronic
1149358183 17:55866007-55866029 TTTCACAGGTAGTGAGGGCAGGG - Intergenic
1151320092 17:73347778-73347800 TGTCCCAGGCTGTGTGGGGAAGG - Intronic
1155437206 18:25826087-25826109 AATGACAGGCAGTGGGTGGAGGG - Intergenic
1160145725 18:76362510-76362532 TCTCAGAGGCACTGTCTGGACGG + Exonic
1160312085 18:77803686-77803708 TCTCACAGGCATTATGTTGAGGG - Intergenic
1160401253 18:78612978-78613000 TTTCTCTGGCAGGGTGTGGAGGG - Intergenic
1160506863 18:79432262-79432284 AGTCACAGGCCCTGTGTGGAGGG + Intronic
1161129523 19:2579764-2579786 TTTCCCAGGAACTCTGTGGATGG + Intronic
1163030796 19:14542927-14542949 TCTCTCAGGCAGTCTGTGAATGG - Intronic
1164865078 19:31597995-31598017 CTGCACACGCAGTGTGTGGTAGG - Intergenic
1165261096 19:34618691-34618713 TTTCACATGCAGGGTGTGTAAGG - Intronic
1165387967 19:35522829-35522851 TTACACAGTCAGTAAGTGGAAGG - Intergenic
1168646173 19:58060353-58060375 TTTCAGAGGCAGGCTGTGGTTGG - Intronic
925082358 2:1080314-1080336 AGTCACAGGCAGTGTCTGGAAGG - Intronic
925160557 2:1680837-1680859 CTTCCCAGGCAGTGTGGGAAGGG + Intronic
925855321 2:8123878-8123900 TTCCAGAGGCAGTGTGTTGCAGG - Intergenic
926559001 2:14394738-14394760 TTTCAGAGGCCTTGTGTGGCTGG + Intergenic
926710327 2:15874480-15874502 TTAAACATGCAGTGTGTGTAGGG - Intergenic
926867718 2:17377889-17377911 TTACACAGACTGAGTGTGGAGGG - Intergenic
928373032 2:30754889-30754911 TTTCAATGGCAGTGTGGGAACGG - Intronic
928930947 2:36623529-36623551 TTTCACTGGAATTGTGTGCAGGG + Intronic
929043906 2:37772511-37772533 TTTCCCAGGCAGTGAGATGAGGG - Intergenic
929302270 2:40319116-40319138 GTTAACAGGCAGTGTGGGAATGG + Intronic
930292344 2:49510845-49510867 TTTGAAAGGCAGTGCGTTGAAGG - Intergenic
930995323 2:57710318-57710340 TTTCACAGTCAGTTTGGTGATGG + Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931849265 2:66236349-66236371 TCTCAAATGCCGTGTGTGGATGG - Intergenic
933430104 2:82165473-82165495 TTTAACAGGAAGTATTTGGAAGG - Intergenic
934118972 2:88822304-88822326 TCACACAGGCAGTGCGTGGTGGG + Intergenic
934647674 2:96068519-96068541 GTTCCCAGGCAGGGTGTGCAGGG + Intergenic
935332492 2:101987257-101987279 TTACAAAGGCTGTGTGTGGATGG + Intergenic
936162423 2:110094655-110094677 TCACACAGGCAGTGCGTGGTGGG + Intronic
936182237 2:110276711-110276733 TCACACAGGCAGTGCGTGGTGGG - Intergenic
936728852 2:115357242-115357264 TTTTACAGGCACTAGGTGGAAGG - Intronic
936729190 2:115360420-115360442 TTTCACAGGCAGTGTGTGGAAGG + Intronic
943536075 2:189152436-189152458 TTTCACATACATTGTGTGTATGG - Intronic
943921608 2:193713730-193713752 TTTCAGAGGCAGAGGGTGGGGGG - Intergenic
944635804 2:201675025-201675047 TTTCAAAGGTAGTTTGGGGAGGG - Intronic
946164425 2:217855303-217855325 TTTCACGGGCAGGATGAGGAAGG - Intronic
948308159 2:236965339-236965361 CTGCACAGGCAGTGGGTGTACGG + Intergenic
948507612 2:238440470-238440492 CAACACAGGCAGTATGTGGAGGG - Intronic
948694864 2:239728102-239728124 TTTCAAGGGCAATGAGTGGAGGG + Intergenic
1170299640 20:14868773-14868795 GGTTACAGGCAGTGTGTGGGTGG + Intronic
1170368950 20:15627488-15627510 TTTCAAAGGCAGTTTGGGGAAGG + Intronic
1171017479 20:21555061-21555083 TTTCACAGGAAGTGGGTGCAGGG + Intergenic
1171354925 20:24536625-24536647 TTCTCCAGGCTGTGTGTGGAAGG - Intronic
1172119748 20:32591063-32591085 TTCCACAGGCAGTGTGGCGCGGG - Intronic
1172578837 20:36030853-36030875 GGTCAGAGGCTGTGTGTGGACGG + Intergenic
1173542836 20:43867525-43867547 TGGCAGAGGCTGTGTGTGGATGG - Intergenic
1175038946 20:56027432-56027454 TTTCACACACAGTGTATGGCTGG + Intergenic
1175494513 20:59404352-59404374 TTCCCCAGACAGTGAGTGGATGG - Intergenic
1176984970 21:15425228-15425250 GTTTACAGGCAGTGTGTTTAAGG + Intergenic
1177556176 21:22691411-22691433 TTTCTCAGGGAGTGTGTGGGAGG + Intergenic
1177984434 21:27955943-27955965 TGTGACATGCTGTGTGTGGAAGG - Intergenic
1180128124 21:45805649-45805671 TTTCACAGGGAGAGTGTGACTGG + Intronic
1180927816 22:19568225-19568247 GTTCACAGGCAGTGTGAGATGGG + Intergenic
1184158605 22:42684938-42684960 TCTCACAGGGAGTTTGTGGCCGG + Intergenic
1203296031 22_KI270736v1_random:43908-43930 TTTCCCAGGCAGTGAGATGAGGG - Intergenic
950737871 3:15025253-15025275 ATTCCCAGTCTGTGTGTGGATGG - Intronic
951033983 3:17912920-17912942 TTTTGCAGGCACTGTGTGAATGG - Intronic
953337882 3:42109368-42109390 ATTCACAGGCAGTGTGCCTAGGG - Intronic
955012366 3:55030832-55030854 TTTGATAAGCAGTGTTTGGAGGG + Intronic
959167389 3:102797807-102797829 TTTCAAAGGCAGAGTGAGGTGGG + Intergenic
961791691 3:129380982-129381004 TTTCAGAGGGAGAGTGGGGAGGG + Intergenic
961805713 3:129487933-129487955 TTCCAGAGGCAGAGTGGGGAGGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963001545 3:140686351-140686373 TTTCTGAGCCAGTGTGAGGAAGG + Intronic
963834932 3:150048487-150048509 GTGCCCAGGCAGTGGGTGGAAGG - Intronic
964343861 3:155736515-155736537 TTTTGCAGGCAGTGTGTTTATGG - Intronic
966737761 3:183202421-183202443 GTTCACAGGAAATGTGTGCATGG - Intronic
967057904 3:185846152-185846174 TGTTACAAGCAGTGTGTGGTGGG + Intergenic
967248969 3:187517635-187517657 GTTCACAGAAAGTGAGTGGATGG + Intergenic
968202044 3:196763064-196763086 TTTCCCAGGCAGGGGGTGGGGGG - Intronic
968718506 4:2179983-2180005 TTGAACAGGTAGTGTGTGCAAGG + Intronic
969900695 4:10346450-10346472 TTTCTCAGGGAGTCTGGGGATGG + Intergenic
970644164 4:18100414-18100436 TAACACAGCCATTGTGTGGAGGG - Intergenic
970743537 4:19266745-19266767 TTCCACATGCAGTGAGAGGAGGG + Intergenic
971074214 4:23129330-23129352 TTCCAAAGGCAGTTTGGGGAAGG + Intergenic
971253864 4:24996052-24996074 TTTCAGAGGCAGCGTTTGGATGG + Intergenic
972574885 4:40342727-40342749 TTTTGAAAGCAGTGTGTGGAAGG + Intronic
974699180 4:65417047-65417069 GTTCACATGCAGTGAGGGGACGG + Intronic
976972274 4:91118923-91118945 TTCCACAGGCAGTCTGGGTAAGG + Intronic
979055155 4:115984244-115984266 TTCCACAGGCAGGGTGTGGTGGG - Intergenic
979205044 4:118029291-118029313 TTTCACAGGAAATGTCTGCAAGG + Intergenic
981148452 4:141353324-141353346 TTTAACAGGAAGTGGGTGGCTGG - Intergenic
981738725 4:147980546-147980568 TTTCAAAGACAGGGTTTGGAAGG + Intronic
981985953 4:150856024-150856046 TATCAGAGGCAGTGTGTGCCAGG + Intronic
982239161 4:153281208-153281230 TTTCATATGCTGTGGGTGGAAGG + Intronic
985620720 5:953600-953622 TTTCCCCTGCAGTGTGTGCAGGG + Intergenic
986392235 5:7297732-7297754 TTTGACAGGCTGGGTGTGTAGGG - Intergenic
988891251 5:35619141-35619163 GTTCACAGGGAGTGTGTAGATGG - Intronic
989259059 5:39398827-39398849 TTTAACATGCAGTGGGTAGAAGG + Intronic
992956093 5:81909899-81909921 TTGAACAGGCAGTGTGTGTGGGG - Intergenic
993620592 5:90163235-90163257 TATCACAGGAAGAGTGAGGAAGG + Intergenic
993659123 5:90608654-90608676 TTTCTCAGGCTGTGACTGGAGGG + Intronic
994696948 5:103084431-103084453 TTTCTCAGGCAGTTTTTAGATGG + Intergenic
996966087 5:129307990-129308012 TTTCACTGCCAGTTTCTGGAGGG - Intergenic
997431671 5:133845124-133845146 TCACAGAGGCAGGGTGTGGATGG + Intergenic
998040872 5:138950400-138950422 TCTCCCAGGCAGTGTCGGGATGG - Intronic
999059621 5:148619342-148619364 TTGAACAGGCAGTGTTTGTAAGG - Intronic
999303361 5:150504556-150504578 TGTCACGGGCAGTCAGTGGAGGG - Intronic
999926175 5:156380911-156380933 TTTTCCAGGCATTGTGTGCATGG + Intronic
1001256107 5:170184485-170184507 TCTCAAAGGCTGTGTGTGGGCGG - Intergenic
1001263615 5:170255405-170255427 TTCCACATGCAGTGTGTGCACGG - Intronic
1002139431 5:177130038-177130060 TTTCACAGGCAGTATGTGTAGGG + Intergenic
1005200950 6:23343172-23343194 TGCCACAGGGAGGGTGTGGAGGG - Intergenic
1007378072 6:41469838-41469860 TTACACAGGCAGAGTGGGGATGG + Intergenic
1009211884 6:60871716-60871738 TTTCATAGCCAGTGAGAGGAAGG + Intergenic
1009600913 6:65797962-65797984 ATTCTCAGGCGGTGTGGGGATGG + Intergenic
1009609234 6:65917842-65917864 TCTCACAGACATTGTATGGAGGG - Intergenic
1013191825 6:107810223-107810245 TATGGCAGGCAGTGTGGGGAGGG - Intronic
1016642375 6:146363929-146363951 TCTCACTGGCAGTGGTTGGAAGG + Intronic
1018073754 6:160191206-160191228 CTTCACAGGGAGTGGGTGGGAGG - Intronic
1018326717 6:162678084-162678106 TTTCAAAATCATTGTGTGGAAGG - Intronic
1018836950 6:167492327-167492349 TCTCTCAGGCAGTGGGAGGATGG + Intergenic
1018858340 6:167691653-167691675 CTTCACAGGCAGTGGGCGTATGG + Intergenic
1019060900 6:169256727-169256749 TTTTAAATGCAGTGTGTGGCAGG - Intergenic
1022294019 7:29033034-29033056 TCGCACAGGCAATGTGTAGAAGG + Intronic
1022435090 7:30375492-30375514 TTTCACAGGCCTTGCGTGGTAGG - Intronic
1022983479 7:35626558-35626580 TTTCCCAGACAGTGGGTGGAGGG - Intergenic
1025250940 7:57350986-57351008 TAACATAGGCAGTGTGTGGAGGG + Intergenic
1027305781 7:76895128-76895150 TCTTACAGGCAGGGTCTGGACGG + Intergenic
1027999301 7:85470737-85470759 CTTTAGAGGCAGTGTGGGGATGG - Intergenic
1029129236 7:98317645-98317667 GGTCCCAGCCAGTGTGTGGATGG - Intronic
1030425800 7:109375792-109375814 TTTCAGAGAAAGTGTGGGGATGG - Intergenic
1030434007 7:109491797-109491819 TTTCACAGGTATTGTGTTTAAGG + Intergenic
1031669945 7:124530073-124530095 TGTGACAGGCAGGGTTTGGAGGG - Intergenic
1032433473 7:131881686-131881708 TTTGACAGGCCAGGTGTGGAGGG - Intergenic
1032501097 7:132400559-132400581 TTTCCCAGGCCCTGTGTGAATGG + Intronic
1034076122 7:148232860-148232882 TTTCACAGGGTGTGTGCTGAGGG - Intronic
1034307226 7:150054022-150054044 TTTCACAGTCATTGTGTTGTTGG - Intergenic
1034799620 7:154046661-154046683 TTTCACAGTCATTGTGTTGTTGG + Intronic
1035126718 7:156613204-156613226 TTTCTCAGTCAGCGGGTGGAGGG - Intergenic
1035766220 8:2107701-2107723 ACTCACAGGCAGGGTGGGGAAGG + Intronic
1036000173 8:4593955-4593977 CTCCACAGGCAGGGTTTGGAGGG - Intronic
1037618990 8:20546441-20546463 TTTCACAGGCTGTGTGCCCAGGG - Intergenic
1037709041 8:21341142-21341164 TCTCAAGGGCAGTGTGTTGAGGG - Intergenic
1038379199 8:27076314-27076336 TTTCTCAGGCACCCTGTGGATGG - Intergenic
1038498589 8:28024762-28024784 TTTCAGAGGCAGTGGGGAGAAGG - Intronic
1038696055 8:29807338-29807360 TGTCACAGGCAGGGCGGGGAAGG - Intergenic
1041785339 8:61626314-61626336 TTTCACAGTCTGTGTCTGGTTGG - Intronic
1049744104 8:144255890-144255912 CTTCACAGCCAGTGTGAGAAGGG - Intronic
1050056343 9:1659659-1659681 TTTGGCAGGGAGTGTGTGAAAGG - Intergenic
1050100686 9:2116187-2116209 TTTCACAGGCTTTCTGTGGTTGG - Intronic
1053472506 9:38356990-38357012 TTTCACCTCCAGTGGGTGGAGGG + Intergenic
1055118507 9:72631721-72631743 TTCAATAGGCAGAGTGTGGATGG - Intronic
1056309047 9:85321295-85321317 CTGCACAGGCATTGTGTGGTGGG - Intergenic
1057912633 9:99031879-99031901 TTTCACAGACTGTCTGTAGATGG + Intronic
1061721788 9:132556518-132556540 TTTCTCAGGCAGTTTTTGAAAGG + Intronic
1061938867 9:133873492-133873514 TTTCACAGGCAGCGTCTGCCCGG - Intronic
1186217793 X:7318452-7318474 TTCCATAGGCAGTGTGTGCTCGG + Intronic
1191874726 X:65784623-65784645 TTTCAGAGGCATTATGAGGAAGG - Intergenic
1192112882 X:68383293-68383315 TTAAACAGGCAGTGTTTGGCTGG + Intronic
1195470060 X:105220419-105220441 TTTCACTAGCCCTGTGTGGATGG + Exonic
1195732711 X:107982149-107982171 TTTCACTAGCCCTGTGTGGATGG + Exonic
1197674673 X:129316347-129316369 TTTCAAAGGCGGTGTGAGGGTGG + Intergenic
1198038830 X:132828500-132828522 TTTGACAGGCAGTCTCTGAAGGG - Intronic
1198166788 X:134065428-134065450 TTGGAGAGGCAGTGTGGGGAGGG - Intergenic