ID: 936732902

View in Genome Browser
Species Human (GRCh38)
Location 2:115405492-115405514
Sequence CTGTGGGTCTGGAGTCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 402}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936732897_936732902 9 Left 936732897 2:115405460-115405482 CCTAGGCTGGTGTCGCATGTTGC 0: 1
1: 0
2: 1
3: 42
4: 843
Right 936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG 0: 1
1: 0
2: 2
3: 42
4: 402
936732896_936732902 20 Left 936732896 2:115405449-115405471 CCTGCAGATTTCCTAGGCTGGTG 0: 1
1: 0
2: 4
3: 33
4: 338
Right 936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG 0: 1
1: 0
2: 2
3: 42
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936732902 Original CRISPR CTGTGGGTCTGGAGTCCAGA GGG Intronic
900215301 1:1478459-1478481 CTGTGGGTCTGGATTCCTCCAGG + Intronic
900222560 1:1517126-1517148 CTGTGGGTCTGGATTCCTCCAGG + Intronic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
901493056 1:9606353-9606375 CTTTGGTTCTGAAGTCCAGGTGG + Intronic
902127380 1:14227289-14227311 CTATGGGTCAGGAATTCAGAAGG + Intergenic
902466174 1:16620104-16620126 CTGAGGGTATGGGGGCCAGATGG - Intergenic
902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG + Intronic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903282678 1:22258953-22258975 CGGAAGGTCTGGAGTCTAGAAGG - Intergenic
903303165 1:22393243-22393265 GTGGGGGTCAGGAGTCCAGCAGG + Intergenic
904006128 1:27364211-27364233 CTGTGGGTGTGGCCTCCAGCAGG + Exonic
904839391 1:33362307-33362329 CTGTGAGTCTGGGGTGCAGGAGG + Intronic
905527263 1:38648504-38648526 GTGAGTGTCTGGAGTGCAGATGG - Intergenic
906326742 1:44850905-44850927 CTGTGGCTTTGGAGGCCAAAAGG + Exonic
906690728 1:47791228-47791250 CTGTGGTTCTGGAGTCTGGATGG - Intronic
906692484 1:47801693-47801715 CTGTTGCTCTGAAGTCCAGAGGG - Intronic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
907490119 1:54803919-54803941 CAGTGGCTCTGGAGTCTGGACGG + Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908353441 1:63308746-63308768 CTGTGGATCGGGAATTCAGAAGG - Intergenic
909198523 1:72658435-72658457 CTATGGGTCTGCAATTCAGAAGG - Intergenic
909673157 1:78211503-78211525 CAGTCTGTTTGGAGTCCAGAGGG + Intergenic
911803481 1:102174938-102174960 ATGTGGGTCTGGAATCCAAGTGG - Intergenic
912736185 1:112151500-112151522 GTATGGGTCTTGAGTTCAGAAGG + Intergenic
912922029 1:113877959-113877981 CTGTGGGTATGGAATTGAGAAGG + Intergenic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
914901284 1:151712474-151712496 CTGTCGGTCTGCAGTCAGGAAGG - Intronic
915466658 1:156102328-156102350 CTCTGGGCCTGGGGTACAGAGGG + Intronic
915894256 1:159799137-159799159 CTCTGGGTCTGGCCTACAGAGGG - Intergenic
916056866 1:161074041-161074063 CTAAGGGTCTGGAGCACAGATGG - Intronic
916418783 1:164616976-164616998 CTCTGGATCTGGACTCCAGGTGG - Intronic
917515327 1:175702424-175702446 CTGTGGGTCTGGAAGCTGGAAGG - Intronic
918632909 1:186740139-186740161 ATGTGGGTTTGGAGTTCAGGAGG - Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
921122208 1:212147057-212147079 CTGTGGGTGTGGGGTACAGTAGG - Intergenic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
923280600 1:232439394-232439416 CTTTGGGTCTGGCGACCTGATGG - Exonic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924133735 1:240940372-240940394 CTGTGGATCTGGAGACCAGGTGG - Intronic
1063015582 10:2073749-2073771 ATGTGGGTATGGAGTCAAGGTGG - Intergenic
1063116994 10:3078786-3078808 CTGTGGGTCTGCAGTCAGCAAGG + Intronic
1063371855 10:5527390-5527412 CTCTGGGGCTGGATTCCTGAGGG + Intergenic
1064717634 10:18193390-18193412 CTGTGGGTGTGAAGTGCAGGTGG + Intronic
1065072892 10:22045710-22045732 CTGTGGGTCAGGAATCCAGAAGG - Intergenic
1066171767 10:32856442-32856464 CTGTGCGTGTTCAGTCCAGAGGG - Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067724880 10:48762511-48762533 CTGTGGGTCAGGGATTCAGAAGG + Intronic
1067841791 10:49686908-49686930 CTCTGGTTCTTGATTCCAGAGGG - Intronic
1070318483 10:75336616-75336638 CTGTGGGTCAGATGTCCAGGTGG + Intergenic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1071065357 10:81627170-81627192 CTGTTCATCTGGAGTCCAGTTGG - Intergenic
1071461724 10:85903120-85903142 CTATGAGTCTGGAGTTCAGAGGG - Intronic
1071786439 10:88905565-88905587 CTTTAGGTCTGGAGTAGAGATGG + Exonic
1071944180 10:90622896-90622918 CTTAGTGTTTGGAGTCCAGAAGG + Intergenic
1073504737 10:103975189-103975211 GTGTGGATCTGGAGTTCAAAAGG - Intronic
1074693575 10:116028361-116028383 CTGTGGGCCTGCTGTCCACAGGG - Intergenic
1075837693 10:125469732-125469754 ATGTGCTACTGGAGTCCAGAGGG - Intergenic
1076088476 10:127657547-127657569 CTGTGGGGCTGGAGTCCTGCAGG - Intergenic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1076383605 10:130041211-130041233 CTCTGGTTCCTGAGTCCAGATGG + Intergenic
1077500889 11:2909364-2909386 CGGGGGGACTGGAGTCCAGGTGG + Intronic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1079747780 11:24155171-24155193 ATGTGGTTCTGTAGACCAGAGGG - Intergenic
1081617029 11:44597208-44597230 TGGGGAGTCTGGAGTCCAGAGGG - Intronic
1083140118 11:60714740-60714762 CTTTGGGTGTGGAGACCTGAGGG - Intronic
1083616291 11:64028246-64028268 CTGAGGGTCTGGAGCCGAGGGGG + Intronic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1084500078 11:69530231-69530253 CTCTGAGTCTGGAGTCCAGGAGG + Intergenic
1085278362 11:75314269-75314291 CTGGGAGGCTGGAGTCAAGAGGG + Intronic
1087198518 11:95322227-95322249 CTGTGGGCTTGGTGCCCAGAGGG - Intergenic
1088408982 11:109512714-109512736 CTGTGGCTCAGGTGTCCTGAGGG - Intergenic
1088712718 11:112523254-112523276 CTGTGGGTCTGAAAACCATAAGG + Intergenic
1088913273 11:114208123-114208145 CTATGGTGCTGGAGACCAGAAGG - Intronic
1089004034 11:115075772-115075794 CTGTGGGTATAGGGTCAAGATGG + Intergenic
1094426766 12:30324231-30324253 CTGAGGTTGTGGAGTCCAGCAGG - Intergenic
1096740068 12:53686714-53686736 CTGTTGGCCTGTAGTGCAGATGG - Intergenic
1098014803 12:66092846-66092868 CAGTGGGTCTGGAGCCAAGCAGG - Intergenic
1098590141 12:72201499-72201521 CAGAGGGTCTGGAGCCTAGAGGG - Intronic
1100786522 12:98084490-98084512 CTCTAGGTCGGAAGTCCAGAGGG + Intergenic
1102655737 12:114480943-114480965 CTCAGGTCCTGGAGTCCAGAAGG - Intergenic
1103879933 12:124158302-124158324 CTGTGGGTGTTGAGTCCCCAAGG + Intronic
1103973440 12:124686796-124686818 CTGTGGGTCTGGAATCTCGGGGG + Intergenic
1104663314 12:130628054-130628076 CTGGGTGTCTGGAGCACAGATGG - Intronic
1104820561 12:131675100-131675122 CTGTGAGTCCCGTGTCCAGATGG + Intergenic
1107153407 13:37139064-37139086 CTGTGGTCCTGGATTTCAGAAGG + Intergenic
1107319118 13:39166955-39166977 TTGTTGGTCGGGAGTCTAGAAGG - Intergenic
1108446111 13:50510608-50510630 TTATGGGGCTGGAGTTCAGAAGG + Intronic
1108602614 13:52007728-52007750 CAGTTGGTCAGGAGTACAGATGG - Intronic
1109269336 13:60236870-60236892 CGGTGGGTGTGGAGAACAGATGG - Intergenic
1111971706 13:94923693-94923715 TTGTGGGTCAGGAATTCAGATGG - Intergenic
1115282336 14:31678077-31678099 CTGTGGGTCTGTAGTGCTGGTGG - Intronic
1117074787 14:52091046-52091068 CTGTGGGTCTGGGGTCAAGAGGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117744952 14:58860268-58860290 CTAAGGGTATGGAGTCCAGCTGG + Intergenic
1117990584 14:61429118-61429140 CTGTTGGTCTGGAGAATAGAAGG + Intronic
1118154804 14:63229363-63229385 CTGTAGGTCAGAAGTCCAGCAGG + Intronic
1119035170 14:71223626-71223648 TTTTGGTTCTGGAGTCAAGATGG - Intergenic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119472270 14:74907490-74907512 GTGTGGGCCTGGATTCCTGAAGG + Exonic
1119572760 14:75690654-75690676 CTGTGGTTCTGGGCTACAGAGGG - Intronic
1120121068 14:80680632-80680654 ATGTGGGTATGGACTGCAGAGGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120280924 14:82436812-82436834 CTGTAGGTCATGAGTCCAGGTGG - Intergenic
1120978293 14:90268658-90268680 CTGTGTCCCTAGAGTCCAGATGG - Exonic
1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG + Intronic
1121733435 14:96202204-96202226 CTGTGGGGCTAAAGTACAGAGGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122781946 14:104147445-104147467 CTGTGGGTCTGCAGCTCTGAAGG - Intronic
1123064850 14:105612632-105612654 ATGTGAAACTGGAGTCCAGAGGG - Intergenic
1123074148 14:105658272-105658294 ATGTGAAACTGGAGTCCAGAGGG - Intergenic
1123094110 14:105757223-105757245 ATGTGAAACTGGAGTCCAGAGGG - Intergenic
1125282484 15:38057532-38057554 CTGTAAGTCAGAAGTCCAGAGGG + Intergenic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1125899124 15:43329247-43329269 TTGTGGGACTGGAGTTCAGTGGG - Exonic
1125929387 15:43589757-43589779 GGGTGGGGCTGGAGTCCAGGAGG - Intronic
1125942554 15:43689589-43689611 GGGTGGGGCTGGAGTCCAGGAGG - Intergenic
1126803963 15:52326911-52326933 CTGTTTCTCTGGAGTCAAGAGGG + Intronic
1126957632 15:53951889-53951911 CAGTGGATCTGGAGACCAGCTGG + Intergenic
1128543396 15:68552019-68552041 CTGAGGTTCTGGAACCCAGAAGG + Intergenic
1128559305 15:68654262-68654284 CTCTGGATTTGGAGTCCAGGGGG + Intronic
1129372361 15:75105553-75105575 CTTGGGGGCTTGAGTCCAGAAGG - Intronic
1129870136 15:78934644-78934666 ATGGGGTTCTGGTGTCCAGATGG + Intronic
1130788445 15:87125651-87125673 CTGTGGCTCCTGAATCCAGAAGG - Intergenic
1131359223 15:91774722-91774744 CTCTGGGTATGAAGTCCAGTGGG + Intergenic
1131846535 15:96495160-96495182 CTGTGGGGCTGGAATCATGAGGG + Intergenic
1132352017 15:101145701-101145723 GTGTGAGTCTGGAGTCCTGGGGG - Intergenic
1133214114 16:4280682-4280704 CTGAAGGTCAGAAGTCCAGATGG + Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1135694081 16:24572182-24572204 CTTCGGGTCTGGCTTCCAGAAGG - Exonic
1136043956 16:27601252-27601274 TCGTGGGTCTGGCGTCCTGATGG + Intronic
1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG + Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG + Intronic
1137723385 16:50640988-50641010 GTGGGGGTGTGGAGTCCAAATGG + Intergenic
1138510932 16:57508089-57508111 CTGGAGGGCTGGAGTGCAGAGGG + Intergenic
1139187376 16:64822838-64822860 CTGTAGGTCAGAAGTCCAGGTGG + Intergenic
1139431601 16:66913732-66913754 CCCTGGGCCTGGAGTCCAGGTGG + Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141187354 16:81797482-81797504 CTGTGGGTCAGGACTACCGAAGG - Intronic
1142075543 16:88115611-88115633 CTCTAGTTCTGGAGACCAGAAGG + Intronic
1142114938 16:88351652-88351674 CTGTGGATCTGAGGTCCAGACGG + Intergenic
1142334522 16:89479038-89479060 GTGTGGGTCTTGAGGCCCGAAGG - Intronic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1142980067 17:3666536-3666558 CTGCGGGGCAGGTGTCCAGAAGG + Intronic
1143023969 17:3930205-3930227 CTGAGGGTCAGGGGTCCAGGTGG - Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1145885921 17:28382422-28382444 TTTTGAGTCTGGAGTCAAGATGG + Intronic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1146484171 17:33229981-33230003 CTGGGATTCTGGAGCCCAGATGG + Intronic
1147170848 17:38617878-38617900 CAGGGTGTCTGGTGTCCAGAAGG - Intergenic
1147506406 17:41021853-41021875 TTGTGGGTCAGGAGTACAGCAGG - Intergenic
1148560041 17:48600872-48600894 CTGTGAGTCTGCAGTCCTGTGGG + Intronic
1150318317 17:64188361-64188383 CTGTGGGTCAGGTGCCCGGACGG + Exonic
1151431978 17:74069912-74069934 CTGTGGGGCTGGTGTAAAGAAGG - Intergenic
1152941618 17:83175705-83175727 CTGCTTGCCTGGAGTCCAGAGGG + Intergenic
1153946267 18:10020569-10020591 CTGTTGGTCTGGATTGCAGCTGG + Intergenic
1154151695 18:11911083-11911105 CTGTAGGTCAGGAGCCCACACGG - Intergenic
1155066446 18:22273339-22273361 CTGTGGGTCAGGAGTCAAAGTGG + Intergenic
1156310561 18:35918489-35918511 CTGGGGGTCAGGAGTGCAGAGGG + Intergenic
1157446266 18:47748833-47748855 CTGTGATCCTGGAGGCCAGAGGG - Intergenic
1157719691 18:49914210-49914232 CTGTGGGGCTAGAGCCCAAAAGG + Intronic
1158309746 18:56145178-56145200 CTGTGGATCTGGGGTCAAGATGG - Intergenic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1159220337 18:65454358-65454380 CTCTGGTTCTGGGATCCAGATGG + Intergenic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1160716985 19:581049-581071 CTGGAGGGCTGCAGTCCAGAGGG - Intronic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1162831713 19:13288718-13288740 CCAGGGGTCTGTAGTCCAGAAGG - Intronic
1163622646 19:18369971-18369993 TTGTGGGGCTGGAGTTCAGCTGG + Intergenic
1163823366 19:19509075-19509097 CTGTGGGGATGGAGTCCCCACGG + Intergenic
1164601992 19:29568452-29568474 GTGAGGGACAGGAGTCCAGAGGG + Intergenic
1165050770 19:33140042-33140064 CTGTGGGCCAGGTGTCCATAAGG - Intronic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165333442 19:35154109-35154131 CCCTGGGTCTGGGGTGCAGACGG - Exonic
1165464927 19:35968325-35968347 CTGTGGGTCTCCTGTCCTGAAGG + Intergenic
1165495237 19:36148854-36148876 CTGTGGGTATGGACACCTGAGGG + Intronic
1165712134 19:38019377-38019399 TAGTGAGTCTGGAGTCCAGGTGG + Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1165829038 19:38721475-38721497 CTGTGGGGCAGGAGTCTGGAGGG - Intronic
1165856203 19:38880546-38880568 CTGGGGCTCTAGAATCCAGAGGG - Intronic
1166026942 19:40095342-40095364 ATTTGGGTCTGGATTCCACAGGG - Intergenic
1167052315 19:47086733-47086755 CTGTGTGTCTGGGGTGCTGAGGG - Intronic
1167073910 19:47237316-47237338 CTGTGGGCTGTGAGTCCAGATGG + Intergenic
1167956541 19:53069842-53069864 CTGTGGGTTTGGACACTAGAAGG + Exonic
1168361593 19:55745379-55745401 CTGAAGGTCTGGAGTGCATAAGG - Intergenic
926830639 2:16958507-16958529 CTGTGGGTCTGGAGCCATGGAGG - Intergenic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
929195621 2:39181454-39181476 CTGCAGGTCTGGAGTTCACAGGG - Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
930404866 2:50942255-50942277 CTGTGGGAATGGAGCCCACATGG + Intronic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
933586230 2:84182198-84182220 CTGTAGGTCAGAAGTCCAGCTGG - Intergenic
935609544 2:105006723-105006745 CTGTGTGACTGCAATCCAGAGGG - Intergenic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
936715392 2:115181353-115181375 CTGTTGGTCAGGAGTTCAGGTGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937039049 2:118807092-118807114 CTCAAGGTCTGGAGCCCAGAGGG + Intergenic
942220103 2:173760460-173760482 CTGTGGGGCCGGAGCCCCGAGGG - Intergenic
944537876 2:200729141-200729163 GTGTGGGTCTGCATTCTAGAGGG - Intergenic
944566384 2:200995776-200995798 TTGTGGGTCAGGAATCCAGATGG - Intronic
946646548 2:221843546-221843568 CTGTAAGTCAGAAGTCCAGAAGG + Intergenic
946798799 2:223386856-223386878 CTGTGGGGATGGAGTCCTTAGGG + Intergenic
947126900 2:226878719-226878741 CTGTGGGTCAGGAATTCAGAAGG - Intronic
947866279 2:233400049-233400071 CTGTGCATCTGGAGTCCTGCAGG - Intronic
948119886 2:235522226-235522248 CTGTGGACAGGGAGTCCAGATGG + Intronic
948423820 2:237875923-237875945 CTGTGGGGCTGGGCACCAGATGG - Intronic
948471342 2:238182509-238182531 CTTTTGGCCTGGAGTCTAGAAGG + Intronic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948518927 2:238523548-238523570 CTGCGCATCTGGAGGCCAGAAGG + Intergenic
1168861520 20:1049100-1049122 GTGTGGGGCAGGAATCCAGAAGG - Intergenic
1169967313 20:11232305-11232327 CTGAGGGTGGGGAGTTCAGATGG - Intergenic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171978025 20:31607656-31607678 CTGCGGGTCTGGAGTGAAGGTGG + Intergenic
1173423814 20:42926112-42926134 CTGTGGGTCTGACCTGCAGAGGG + Intronic
1173429012 20:42968957-42968979 CTGTGTGTGTGGATTCCACATGG - Intronic
1173745494 20:45433617-45433639 CTGTAGGTCTGGAATTCAGGCGG - Intergenic
1174517447 20:51103420-51103442 CTGTAGGTCAGAAGTCCAGGAGG - Intergenic
1174858614 20:54069516-54069538 CTGTGGAACTGGAGTCCAGTCGG - Intronic
1175331740 20:58169303-58169325 CTGTGGGTCAGAAATCCAGATGG - Intergenic
1175518961 20:59587558-59587580 CTGTGGGTCAGGGGTGCAGGTGG + Intronic
1175519065 20:59588064-59588086 CCGGGGGTCGGGAGTCCTGAGGG + Intronic
1175547479 20:59787926-59787948 CTGTGGGTGTGTATTTCAGATGG - Intronic
1175809343 20:61849426-61849448 CTGTAGGTCAGAAGTCCAGATGG + Intronic
1175819553 20:61901267-61901289 CTGTGGCTCTTGTGACCAGAAGG - Intronic
1175843042 20:62042552-62042574 CTGTGGGGCGGGAGCCCAAAAGG + Intronic
1178257181 21:31064825-31064847 CTGTGGGTCAGGAATTCACAAGG - Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1180236067 21:46459623-46459645 CTGAGGGTCGGGAGTCCGGAGGG - Intronic
1180572039 22:16734219-16734241 CTGAGGGTCAGGAGTATAGATGG + Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1180871424 22:19149273-19149295 CGGTGGGTCTGGACGCGAGATGG + Intronic
1180951744 22:19723578-19723600 CGGTGAGTCTGGAGTCCGGTCGG + Exonic
1181315235 22:21966758-21966780 CTGTCTGTCTGGAATGCAGAAGG - Intronic
1181669900 22:24421153-24421175 CTGTGGGACTGGGGTGCACATGG + Intronic
1181719631 22:24763836-24763858 CTGTGGGAGCGGAGTCCAAAGGG - Intronic
1181931149 22:26402725-26402747 CTGTGGGTCTTGAATCCTTACGG - Intergenic
1182803880 22:33054233-33054255 CTGTGAGTCTGGAGTCGAGGAGG - Intronic
1182977637 22:34638226-34638248 CTGTAGGTGGGGAGTGCAGAGGG - Intergenic
1183464658 22:37973544-37973566 CTGTGGGACTGGGGCCCTGAGGG + Exonic
1183866408 22:40707751-40707773 CTGTGAGGCTGGAGGCTAGATGG + Intergenic
1183954098 22:41368902-41368924 TTGTGGGTGTGGACTCCAAATGG - Intronic
1184879162 22:47294254-47294276 CTGTAGGTCAGAAGTCCAGCAGG - Intergenic
1185107207 22:48880643-48880665 ATGTGGGTATGGACTCCACACGG - Intergenic
949562803 3:5218302-5218324 TTGTGGGGCTGGATGCCAGAAGG + Exonic
949877390 3:8635176-8635198 CAGTAGGTCTGGGGTGCAGACGG + Intronic
950714474 3:14837974-14837996 CTGTGGGTCAGCAGTCTAGTGGG + Intronic
953386691 3:42510401-42510423 CTGTGTTCCTGAAGTCCAGAGGG + Intronic
953422642 3:42766251-42766273 GGGTGGGTCTGGGGTTCAGAAGG + Intronic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
955507781 3:59649023-59649045 CAGTGGGTCTGGTTTCAAGATGG - Intergenic
955958883 3:64318815-64318837 CTGTGGGTCAGAAGTCCAAGGGG + Intronic
957106153 3:75890188-75890210 CTGAGGGTCAGGAGTGTAGATGG - Intergenic
958918271 3:100073784-100073806 CTGTGGGTCTTGTCTCCAGGAGG + Intronic
959592664 3:108097090-108097112 CTGTAGGTCAGAAGTCCAGTAGG + Intergenic
960627790 3:119698399-119698421 CTGTGAGGCTAGAGTCAAGATGG + Intergenic
960944822 3:122958668-122958690 CTGGGGGACTGGGGCCCAGAGGG + Intronic
962388115 3:134949269-134949291 CTGGGAGTCTGGGGTCCAGGAGG + Intronic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
962769386 3:138598469-138598491 CTGTGGGTCAGGAATACAGTAGG + Intergenic
963069257 3:141289382-141289404 CTGGGGGGCTGGTCTCCAGAAGG - Intronic
963935403 3:151047060-151047082 CTGTAGGTCAGAAGTCCAGTGGG - Intergenic
965993252 3:174845929-174845951 CTGTGGGTCTAGTTTCAAGATGG + Intronic
967553913 3:190832029-190832051 CAGTGGCAATGGAGTCCAGATGG + Intergenic
967887872 3:194345628-194345650 CTGTGGGTCCCGAGACCAGCTGG + Intronic
968458301 4:710159-710181 CTGTGGGTTGGGAGACCAGGTGG + Intronic
968728589 4:2259529-2259551 ACGTGGGTCTGTAGTCAAGAGGG + Intronic
970460252 4:16268093-16268115 CTGTGGGTCACTAATCCAGAAGG + Intergenic
972333571 4:38085509-38085531 CTGGGGGACTGGAACCCAGAAGG + Intronic
972709166 4:41577072-41577094 CTGTGGGACTTGAGTACACATGG + Intronic
973687552 4:53388225-53388247 CAGTGAATCTGAAGTCCAGATGG + Intronic
975668033 4:76753438-76753460 GAGTGGATCTGGAGTGCAGATGG - Intronic
981039896 4:140213418-140213440 CTGTGGGTCAGGAGTCTGGGTGG + Intergenic
981379010 4:144050144-144050166 CTGTGGAACTGGAGTACACATGG - Intergenic
982073755 4:151718550-151718572 CTGAGAGGCTGGAGGCCAGAGGG + Intronic
982337965 4:154260817-154260839 CTCAGGGTCTGGCCTCCAGAAGG + Intronic
983399628 4:167246406-167246428 CTGTGGGTCAGGAATTCAGGAGG - Intergenic
983880408 4:172925803-172925825 CTGTAGGTCAGGAGTCCATGAGG - Intronic
985733935 5:1566383-1566405 GTGTGTGTCTGGAGGCCAGGTGG - Intergenic
987121985 5:14776339-14776361 CTGTGAGTCTGGAGTCTGGAGGG + Intronic
987562139 5:19538264-19538286 CTGTAGGTCAGAAGTCCAGGTGG - Intronic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
990791697 5:59487966-59487988 CTGTGTGTCTGATGTGCAGAGGG - Intronic
991508361 5:67350064-67350086 CTGTGGGGAAGGAGTCCAGCTGG - Intergenic
993092304 5:83441409-83441431 CTGGGTGGCTGGAGTCAAGATGG - Intergenic
995444016 5:112222859-112222881 CTTTGGAGCAGGAGTCCAGAAGG - Intronic
995504700 5:112848124-112848146 CTAAGGGTCTGGATTCCAAAAGG - Intronic
997259743 5:132456775-132456797 CTGAGGGTCTACAGGCCAGAGGG - Intronic
997304779 5:132829397-132829419 ATGTGGCTCTGGAGTTCAGCAGG + Intronic
997348272 5:133209867-133209889 ATGAGGCTCTGGGGTCCAGAAGG - Intronic
997921418 5:137982755-137982777 CTGTGGGTCTTGATTTCTGAAGG + Intronic
999054320 5:148557484-148557506 ATGTGTGTCTGGAGCTCAGAGGG + Intronic
1001242225 5:170079558-170079580 CTGTGTGCCAGGAGTCCAGGTGG + Intronic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002426010 5:179176371-179176393 ATGTGGGTCTGGAGCCCTGCGGG - Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1004620509 6:17326703-17326725 CTGAGGGCCTGGAGGCCAGGAGG + Intergenic
1004798395 6:19115667-19115689 CTGTTGGTCTGTATTCTAGATGG - Intergenic
1006347219 6:33492406-33492428 TTGTGGGTCTGGTGGCCACAGGG - Intergenic
1006486805 6:34349533-34349555 ATGTGGGACTGGAGTTAAGAGGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1010452568 6:76019226-76019248 CTGTTGGTCTGGAAACCAGCAGG + Intronic
1010988449 6:82452146-82452168 ATGTGGGTGTGGAGTACAAAGGG - Intergenic
1012593714 6:101015713-101015735 CTGTGAGTTTGGTGTCCAGATGG - Intergenic
1015563374 6:134540322-134540344 CAGTGAGTCTGGAGCCTAGAAGG + Intergenic
1017815965 6:158016925-158016947 CTGGGGTTCTGGCGTCCAGCTGG - Intronic
1018398088 6:163396339-163396361 ATGTGAGTCTGGATCCCAGAAGG - Intergenic
1019042187 6:169116475-169116497 CTGTTGCTCTGGGGTCCAAAAGG - Intergenic
1019431372 7:1001339-1001361 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431379 7:1001355-1001377 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431389 7:1001389-1001411 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431409 7:1001457-1001479 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431427 7:1001527-1001549 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431438 7:1001561-1001583 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431492 7:1001729-1001751 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431506 7:1001781-1001803 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431511 7:1001797-1001819 CTGTGGGTAGGGAGTCCTGTGGG + Intronic
1019431515 7:1001813-1001835 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431522 7:1001829-1001851 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431532 7:1001863-1001885 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431542 7:1001897-1001919 CTGTGGGTGGGGAGTCCTGCGGG + Intronic
1019431568 7:1001981-1002003 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431578 7:1002015-1002037 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431627 7:1002185-1002207 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431654 7:1002291-1002313 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431663 7:1002323-1002345 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431670 7:1002339-1002361 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431680 7:1002373-1002395 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431696 7:1002423-1002445 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431710 7:1002475-1002497 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431720 7:1002509-1002531 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431755 7:1002631-1002653 CTGTGGGTGGGGAGTCCTGCGGG + Intronic
1019431783 7:1002737-1002759 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431803 7:1002804-1002826 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431831 7:1002905-1002927 CTGTGGGTTTGGAGTCCTGTGGG + Intronic
1019431836 7:1002921-1002943 CTGTGGGTAGGGAGTCCTGTGGG + Intronic
1019431854 7:1002991-1003013 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431888 7:1003111-1003133 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431898 7:1003145-1003167 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431922 7:1003231-1003253 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431948 7:1003337-1003359 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431954 7:1003353-1003375 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431968 7:1003405-1003427 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431992 7:1003491-1003513 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432012 7:1003558-1003580 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432018 7:1003574-1003596 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432047 7:1003676-1003698 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432079 7:1003795-1003817 CTGTGGGTTTGGAGTCCTGTGGG + Intronic
1019432085 7:1003811-1003833 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432097 7:1003863-1003885 CTGTGGGTTTGGAGTCCTGTGGG + Intronic
1019432103 7:1003879-1003901 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432117 7:1003931-1003953 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432131 7:1003983-1004005 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019512661 7:1425866-1425888 CTGTGGGTGTGAGGTCCAGGGGG - Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019558744 7:1645496-1645518 CTGTGGGCCCGGAGGCCAGCGGG - Intergenic
1019739190 7:2664350-2664372 CTGGGGTTCTGGGGTCCAGGGGG - Exonic
1022246854 7:28568735-28568757 CAGTTTGTCAGGAGTCCAGATGG - Intronic
1023922913 7:44643684-44643706 GTCTGAGTCTGGAGACCAGAAGG - Intronic
1024524054 7:50333121-50333143 CATTTGTTCTGGAGTCCAGAGGG - Intronic
1024715433 7:52074645-52074667 CTGTGGCACAGGAGACCAGAAGG + Intergenic
1026237275 7:68538356-68538378 CTGTGTGTCTGGAGTCCCACCGG + Intergenic
1026817818 7:73525887-73525909 CTGAGGATCTTGAGTCCAGGAGG - Intergenic
1028347486 7:89800050-89800072 CTGTGAATCTGGGATCCAGATGG + Intergenic
1028985261 7:97004202-97004224 GCGTGGGTCTGGAGACCGGAGGG + Intergenic
1029124965 7:98289401-98289423 CTGGGGGTCTGGACTCATGAGGG - Intronic
1029492669 7:100880798-100880820 ATGTGGGTCTGGAGCACAGGCGG + Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1030541854 7:110840345-110840367 ATATGGGTCAGGATTCCAGAAGG - Intronic
1031433146 7:121697984-121698006 CTGTGTCTCTGGAGTACACATGG - Intergenic
1031485810 7:122322309-122322331 TTGTGGATCTGCAGTCCTGAAGG + Intronic
1032431281 7:131864079-131864101 CAGTGTCTCTGGATTCCAGAGGG + Intergenic
1032501739 7:132404831-132404853 CTGTGGCCCAGGAGACCAGAAGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034289859 7:149921263-149921285 CTGTGGGAGAAGAGTCCAGAAGG - Intergenic
1034309140 7:150071647-150071669 CTGTGGGCCTCGAGGACAGAGGG + Intergenic
1034797715 7:154028989-154029011 CTGTGGGCCTCGAGGACAGAGGG - Intronic
1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG + Intergenic
1036608328 8:10328107-10328129 ATGGGGATCTGGAGTCCAGAGGG - Intronic
1039136626 8:34331069-34331091 TTGTGGGTCAGGAATCAAGAAGG - Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1040569269 8:48593198-48593220 ATGTGGATCTGGTGTCCAGGGGG + Intergenic
1040899486 8:52403290-52403312 CAGTGGCTCTGGTTTCCAGATGG + Intronic
1042198203 8:66252542-66252564 CTGTGTGCCTGGACTCCAAAGGG + Intergenic
1042211264 8:66382865-66382887 CTGTGGGTGTGAACTCCTGATGG - Intergenic
1042303220 8:67308207-67308229 CTGTGTGTCAGGAATTCAGATGG - Intronic
1042616871 8:70659276-70659298 CTGTGGGTAGGGAGACCAAAAGG + Intronic
1043431237 8:80196964-80196986 TTCTGGGTCTTGAGCCCAGATGG + Intronic
1044802884 8:95975206-95975228 CTGGAGGTCTGAAGTCCAAATGG - Intergenic
1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG + Intronic
1048434451 8:134403045-134403067 ATGTGGGTGTGGATACCAGAAGG - Intergenic
1048681074 8:136842620-136842642 GTGTAGGTCTGGAGTCCTGGGGG - Intergenic
1048999790 8:139817537-139817559 CTGTGGGGCAGGAGACCAGGAGG - Intronic
1049393679 8:142385854-142385876 CTGTAGGTCAGAAGTCCAGCTGG + Intronic
1049542899 8:143216438-143216460 CTTGGGGACTGGAGTCTAGAGGG - Intergenic
1049758381 8:144320818-144320840 CTGTGGGTATGGAGCCCTGCAGG - Intronic
1049965555 9:776119-776141 CTGTGGGTCTGGTTTCAAGATGG - Intergenic
1050970927 9:11872594-11872616 CTGTGAGCCTGGAGAACAGATGG + Intergenic
1052984769 9:34478862-34478884 CTCTGGGTCTGGTCTACAGAAGG - Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054729295 9:68684640-68684662 GAGTGAGTCTGGAGTTCAGAGGG + Intergenic
1055407450 9:75989526-75989548 CTGAGGGTCAGGAATTCAGACGG + Intronic
1056570458 9:87810186-87810208 CTGTAGGTCAGAAGTCCAGTCGG - Intergenic
1056790880 9:89624573-89624595 CTGTGGATTTGGGGTTCAGAGGG + Intergenic
1057206678 9:93177766-93177788 ATGGGGGTCTGGAGTGCAGAGGG - Intergenic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1057576373 9:96245810-96245832 CTGTGGGTCCTGAGTCCAAAGGG - Intronic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1060954821 9:127631127-127631149 CTGTGGCTCTGGACTCTAGTTGG + Intronic
1060996412 9:127876873-127876895 CTGTGGGGCCGAAGCCCAGAGGG + Intronic
1061199042 9:129125600-129125622 CTTGGGTTCTGGAGTCCAGCTGG + Intronic
1061221916 9:129257147-129257169 CTCTGAGCCTGGAGGCCAGAAGG - Intergenic
1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG + Intergenic
1062563846 9:137154929-137154951 CTGAAGGTCTGGGGTCAAGAAGG - Intronic
1186345592 X:8689010-8689032 CTGTGAGTCTGCATTCCAGGGGG + Intronic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG + Intergenic
1187673577 X:21692667-21692689 CTGTGGGTGAGAAGTCCAGGTGG - Intergenic
1187701470 X:21967983-21968005 CGGAGGGGCTGGGGTCCAGATGG + Intronic
1188305270 X:28554543-28554565 CTGAATGTCAGGAGTCCAGATGG + Intergenic
1188771848 X:34162847-34162869 ATGTGGGTCTTGAGTCCATAAGG + Intergenic
1189672334 X:43424357-43424379 CTGTGGGTCAGGGGTTCATATGG - Intergenic
1189698748 X:43694290-43694312 CTGTGGGTCCGGAGGCTACAGGG + Intronic
1192268728 X:69558337-69558359 CTTTGGGTCTGAAGGCAAGATGG + Intergenic
1192356397 X:70408113-70408135 CTGTGGGTCGGGGGTCCATCTGG - Intronic
1192856469 X:75017793-75017815 ATGTGAGTCTGAAATCCAGAAGG + Intergenic
1193443247 X:81568141-81568163 CTGGGGGTCTGGGGTTCAAATGG + Intergenic
1195644218 X:107209981-107210003 CTGTGGGTCTGGAGCCAATCTGG + Intronic
1196613775 X:117743675-117743697 GCCTGGGTGTGGAGTCCAGAGGG - Intergenic
1196968879 X:121087133-121087155 CTGTGGGTCTAGTTTCAAGATGG + Intergenic
1199499535 X:148494835-148494857 CTGAAGGACTGGATTCCAGAGGG - Intergenic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1200078738 X:153565185-153565207 CTGTGGGTGTCGGGTGCAGACGG - Intronic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1201421331 Y:13802972-13802994 CTGTGAGTCTGCATTCCAGGGGG - Intergenic