ID: 936733498

View in Genome Browser
Species Human (GRCh38)
Location 2:115411441-115411463
Sequence CTGTATTTGCATCTTGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936733498 Original CRISPR CTGTATTTGCATCTTGGTCA AGG Intronic
901883319 1:12206657-12206679 CTGAATCTGCATCTTGGGCAGGG + Intronic
904250504 1:29220619-29220641 CTGTATTCTCATCTTGACCACGG - Intronic
905180162 1:36160747-36160769 CTGTGTGGGCATCTTGGTCTTGG + Intronic
906800422 1:48732413-48732435 CTTTATGAGCATCTTGTTCAGGG - Intronic
908371063 1:63477890-63477912 CTGTATTTGTATCTTCTTCCTGG - Intronic
909667872 1:78155631-78155653 CAGTATATGCATCTTTTTCATGG - Intergenic
914988171 1:152477305-152477327 CTCTATCAGCATTTTGGTCAAGG + Intergenic
919171026 1:193954274-193954296 ATGTTTTTTCATATTGGTCAAGG + Intergenic
919434079 1:197535079-197535101 CTATATTTGCACATTGGGCAAGG - Intronic
921778421 1:219130714-219130736 ATGTATTTTCATATTGTTCAGGG - Intergenic
922940107 1:229455953-229455975 CTGCATTTGCTTCTGTGTCATGG + Intronic
923765439 1:236888896-236888918 CTGTCTTTCCTTCTTGGGCAGGG + Intronic
1063675336 10:8136348-8136370 CTTTATCTGCATCTTGATGATGG - Intergenic
1063791902 10:9459971-9459993 CTGTATTTTCTTCTTGATCTTGG - Intergenic
1064630180 10:17302690-17302712 CTATATTTTCATTTTGTTCATGG + Intergenic
1065390604 10:25176929-25176951 CAGACTTTGCAGCTTGGTCAGGG + Intronic
1067297096 10:44980815-44980837 CTGTTCTTGCCTCTTGGTCTCGG - Intronic
1067765555 10:49083216-49083238 CTGTAATACCATCTTGCTCAGGG + Intronic
1068973520 10:62983532-62983554 CTGTATTGGCTTCCAGGTCAGGG + Intergenic
1071998391 10:91169243-91169265 CTTTATTTGCATCATGATTAGGG - Intronic
1075512665 10:123084886-123084908 CTGCATATGCATCCAGGTCAAGG + Intergenic
1075789741 10:125075437-125075459 CTCTCTTTGCCCCTTGGTCAGGG + Intronic
1076893835 10:133298995-133299017 CTGTATTTGCTACTTGCTCTTGG - Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1078235539 11:9481454-9481476 CTGTGTTTGCATCTTAGTAGAGG - Intronic
1082301907 11:50516481-50516503 GTGTATTTGCATTTTTGCCATGG + Intergenic
1086247291 11:84769133-84769155 CTGAATTTCCATTTTGGTTAGGG - Intronic
1086494243 11:87385775-87385797 CTGAATTTCCATTTTGGTTAGGG - Intergenic
1086510928 11:87557006-87557028 CTGTATTTATAGCATGGTCAGGG + Intergenic
1086753872 11:90533600-90533622 CTGTCTTTGCATCTGGCCCATGG + Intergenic
1087668693 11:101080629-101080651 CTGAGTTTCCATCTTGGTTAGGG - Intronic
1088599669 11:111463206-111463228 CTGTATTTCCATCTTTGATAGGG + Intergenic
1088946095 11:114514305-114514327 TTGTATTTGCATCCTGGAAATGG + Intergenic
1090992931 11:131837229-131837251 CCGAATTTGCACCTTTGTCAGGG + Intronic
1091871560 12:3895486-3895508 CTGTTTTTTCATCTTGGTTCTGG - Intergenic
1091876545 12:3938965-3938987 CTGGATTTGACTCTCGGTCAAGG + Intergenic
1092002000 12:5040356-5040378 CTGGATTTTCAACTAGGTCAGGG - Intergenic
1092278740 12:7082719-7082741 CAGTGATTGCATCTTGGTCGTGG + Intronic
1093224603 12:16466457-16466479 CTGTGTTAGCATCTTTGTCATGG - Intronic
1096535423 12:52269375-52269397 CTGTATATTCATCTTCGACAAGG - Intronic
1102577567 12:113865952-113865974 TTGTGTCTGCATCTTGGCCAGGG - Intronic
1102797985 12:115705963-115705985 CTGCATGTGCATGTTGGGCAAGG - Intergenic
1103174281 12:118848454-118848476 CTGTTTTTTCATCTTTGTAATGG + Intergenic
1103913827 12:124365865-124365887 CTGTGTTTGGACCTGGGTCAGGG - Intronic
1104617606 12:130283620-130283642 CTGATTTAGCATCTTGGCCATGG + Intergenic
1104677925 12:130727695-130727717 TTGTATTTGCATATTAGACAAGG + Intergenic
1105846213 13:24296540-24296562 CTGGAATTGCAACTTGTTCAGGG - Intronic
1106923991 13:34593818-34593840 CTGTGTTTGCAGCTTTGACAAGG - Intergenic
1109984531 13:69961308-69961330 CTGTATATGCAAATTGGACAAGG + Exonic
1111691349 13:91567090-91567112 CTGTATTTGGATCTTTCTCAGGG + Intronic
1112144619 13:96684529-96684551 CTGTATGCGCATATTGGTAAGGG + Intronic
1112537792 13:100277396-100277418 CTGTGTTTTCATCTTGGTTTTGG + Intronic
1113717445 13:112522353-112522375 CGGTACCTGCTTCTTGGTCAAGG - Exonic
1114392573 14:22326053-22326075 CTGTACTTGCCTCTAGGTCTCGG - Intergenic
1115619193 14:35124010-35124032 CTGTGTTTACATCTTGATGAAGG - Exonic
1117934953 14:60893594-60893616 CTGTATTTTGATCTTGGTTTTGG + Intronic
1121917680 14:97851091-97851113 CAGTATTTGCATCTGTGTAATGG + Intergenic
1122302904 14:100741204-100741226 CAGTGTTCGCATCTTTGTCATGG - Intergenic
1124786192 15:32682949-32682971 CTTTATCTGCATCTCAGTCAGGG + Intronic
1127258776 15:57312723-57312745 CTGCATTTCCAACTTGGCCATGG + Intergenic
1129151556 15:73691773-73691795 TTGAATTTGCCTCTTTGTCAAGG + Intronic
1129223357 15:74148579-74148601 CTGTATTTTCATCCTCATCAGGG + Intergenic
1129832187 15:78678165-78678187 CTGGATTTGCCTCTGTGTCAAGG + Intronic
1130066062 15:80606036-80606058 CTGCATTTCCATCTTGGCCCCGG - Intergenic
1135507728 16:23053182-23053204 CTTTCCTTGCAACTTGGTCATGG + Intergenic
1137818897 16:51424909-51424931 CTGTGTTTTCATCTTGCTCTGGG + Intergenic
1141210448 16:81974368-81974390 CTGCATTTCCATTTTGGTTAGGG - Intergenic
1141442094 16:84036087-84036109 CTTAATTTGCATCATGGTCAGGG - Intronic
1143199683 17:5103801-5103823 CTCAATTTCAATCTTGGTCAGGG + Intergenic
1149079984 17:52643717-52643739 CTGTATGTGTATGTGGGTCAAGG + Intergenic
1150226033 17:63524855-63524877 CTGAATGAGCTTCTTGGTCAGGG - Intronic
1150838972 17:68590767-68590789 CTGCATTTCCATCTTGGTTCGGG + Intronic
1151205428 17:72502885-72502907 CTGACTTTGCTTCTTGTTCAGGG - Intergenic
1153362906 18:4218173-4218195 CTGCCTTTGCTTCTTTGTCAAGG + Intronic
1154362785 18:13677723-13677745 CTGAGTTTGCCTCTTGGTGAAGG + Intronic
1155011121 18:21779561-21779583 CAGTCTTTGCAGCATGGTCATGG + Exonic
1155224764 18:23719598-23719620 CTGTATTTGCATCTGGCTCCTGG - Intronic
1155844591 18:30689685-30689707 CAGTATTTGCCACTTTGTCATGG - Intergenic
1157634638 18:49139270-49139292 AAGTATTTGCCTCTAGGTCATGG - Intronic
1161903321 19:7136151-7136173 CTTGATTTGCATTTTTGTCATGG + Intronic
1163951318 19:20589925-20589947 GAGTATTTGCATCATGATCATGG - Intronic
1164240672 19:23385377-23385399 CTGTATTTGCAGTTTTGTGATGG + Intronic
1164761218 19:30729816-30729838 GTGTGTTTCCATCTTGGTAATGG - Intergenic
1164903616 19:31949008-31949030 GCGTATTTGCATAATGGTCAGGG - Intergenic
1166096571 19:40543022-40543044 CTGTGTTGGCCTCATGGTCAGGG + Intronic
927059366 2:19400976-19400998 CTGTATTTGTTTCTTGTTCCTGG + Intergenic
928838986 2:35582769-35582791 GTGTATTTTAATCTAGGTCAGGG - Intergenic
929327196 2:40629904-40629926 CTGTAATTGCATCTTGGAGGAGG + Intergenic
930505999 2:52283639-52283661 CTCTATTTTTATCTGGGTCAGGG + Intergenic
931851921 2:66260350-66260372 GAGTATTTGCATTTTTGTCATGG + Intergenic
933005503 2:76988403-76988425 CTGAATTAGCAGCTGGGTCAAGG - Intronic
935557664 2:104528098-104528120 CTGCATTTTCATTTTGTTCAGGG + Intergenic
935610333 2:105017058-105017080 TAGTATTTGCTTCTTGGTTAAGG + Intergenic
936733498 2:115411441-115411463 CTGTATTTGCATCTTGGTCAAGG + Intronic
938966113 2:136389990-136390012 CCTTATTTGCATCTTGTGCAGGG + Intergenic
939210547 2:139169803-139169825 ATGTATGTGAATCTTGGGCAAGG + Intergenic
939606785 2:144263412-144263434 CTATATTTGGGTCCTGGTCATGG + Intronic
940102552 2:150058371-150058393 CTGCATATTCATCTTGGTTATGG - Intergenic
940735349 2:157444835-157444857 CTGCATGTGCATATGGGTCAAGG + Intronic
942856929 2:180560092-180560114 CTGTCTTGGCATCTTGTTCTTGG + Intergenic
943259600 2:185642288-185642310 CTGTGTTGGCACCTTGATCATGG - Intergenic
943419017 2:187644512-187644534 ATGTATTGGCATCTAGGTCATGG - Intergenic
944949762 2:204734800-204734822 CTGTATCTTCATCGTGGTGATGG + Intronic
947508512 2:230728906-230728928 CTGTATGTGCATCTGGGGCCGGG - Intronic
1170281069 20:14649614-14649636 CTGGTTTTGGAGCTTGGTCATGG + Intronic
1170454180 20:16517135-16517157 CTGTATTTTCATCTTGTCCTTGG - Intronic
1170566347 20:17609879-17609901 CTTTATTTGCTGCTTTGTCAGGG - Exonic
1170691329 20:18618403-18618425 CTGTAGTGGCATCATGATCATGG + Intronic
1170753208 20:19171161-19171183 CTGTACTTACATCCTTGTCATGG + Intergenic
1172213668 20:33218525-33218547 CCCTATTTGCATCTTGATCTTGG - Intronic
1175022622 20:55866499-55866521 CTGAGTTTACATTTTGGTCAGGG - Intergenic
1178097002 21:29226721-29226743 ATGTATTGGCATCTTGATCGTGG - Intronic
1181994777 22:26868601-26868623 CTATTTTTGGACCTTGGTCAGGG + Intergenic
1182204651 22:28611179-28611201 CTGAATTTGAATGTTGGTCTGGG - Intronic
949149754 3:752320-752342 CTGTATTTGCATGTTTATTATGG - Intergenic
949913575 3:8937607-8937629 CTTTAGTTGTATCTTGGCCACGG - Intronic
951357947 3:21691808-21691830 CTGGATTTGCATAGTGGTGATGG - Intronic
951782344 3:26377816-26377838 CTGTATCTTCATCTGGGTGATGG + Intergenic
951822766 3:26831441-26831463 CTGAATTTGCATTTTGAGCATGG - Intergenic
953049860 3:39331274-39331296 CTGCATTGGCAGCTTGGTCTTGG - Intronic
960040699 3:113147719-113147741 CTGTATTTCCTTCTTTCTCAAGG - Intergenic
962082472 3:132155208-132155230 TGGAATATGCATCTTGGTCAGGG + Intronic
962084429 3:132175009-132175031 CTGAATTTCCATTTTGGTCAGGG - Intronic
962602877 3:137008038-137008060 CTGTATTTGCTTCATGGGAATGG + Intronic
964291478 3:155185691-155185713 CTGTATCCTCATCTGGGTCAGGG - Intergenic
968094471 3:195918541-195918563 CTGGATTTCTATCTTGGTCATGG - Intergenic
969905831 4:10395293-10395315 CTGAGTTTGCATTTTGGTTAGGG + Intergenic
972400716 4:38700483-38700505 CTTTATTCTCTTCTTGGTCAAGG + Exonic
972479779 4:39486341-39486363 CCTTCTTTGCCTCTTGGTCACGG - Intergenic
973335542 4:48952044-48952066 CTGTGTTTGCCTCTGGGGCAGGG + Intergenic
973713631 4:53653603-53653625 CTCTGTGTGCATTTTGGTCATGG + Intronic
974091673 4:57317590-57317612 CTGCATTTGCATATTGTTCTGGG - Intergenic
975316993 4:72965561-72965583 CTGTATTTGTATGTTCATCACGG + Intergenic
976031107 4:80754901-80754923 TTGTGTTTGCATATTGTTCAAGG + Intronic
978084973 4:104640397-104640419 CTGTATTTGTTTCTTGCTAAAGG - Intergenic
979098760 4:116587955-116587977 CTCTATTTTCTTCTTGGTTAGGG + Intergenic
979962560 4:127037646-127037668 CTGAGTTTCCATCTTGGTTAGGG - Intergenic
981849284 4:149209622-149209644 CTTTATTTGCATTATAGTCATGG + Intergenic
982314956 4:154022901-154022923 CTGTATTTAAATCTTGGCAAGGG - Intergenic
986143683 5:5056322-5056344 CTGTCTTTGCATTGTGGTCAAGG - Intergenic
986246035 5:6007764-6007786 CTGTTTTTGAATCTTGGAAAAGG - Intergenic
986354198 5:6907940-6907962 CTGTCTTTGCATCTTGTCCCAGG - Intergenic
986996355 5:13611768-13611790 CTGGATTTGAATCTTGGTTTTGG - Intergenic
988273774 5:29053794-29053816 CAGTGTTTGATTCTTGGTCAGGG + Intergenic
989130890 5:38105752-38105774 CTGATTTTTCATCTGGGTCAAGG - Intergenic
989335717 5:40314679-40314701 CTGGATTTGGCTCTTGGTGAGGG - Intergenic
989558766 5:42827255-42827277 ATTTATTTGCATCATAGTCAAGG + Intronic
990875286 5:60477408-60477430 CTGTTTTTAAAGCTTGGTCAGGG - Intronic
991302754 5:65145061-65145083 CTGGATCTGCATCTGGGGCAAGG - Intergenic
991452227 5:66764436-66764458 CTGTACCTGCATCCTGGACAAGG - Intronic
993073587 5:83197959-83197981 CTGTAAATACATCTTGATCATGG + Intronic
994559432 5:101348108-101348130 CTGAATTTTCATTTTGGTTAGGG - Intergenic
995260795 5:110102275-110102297 TTGTATTTGCATGATGGTCTAGG - Intergenic
995544009 5:113212058-113212080 ATGTATTTGCAGCTTAGTCAAGG + Intronic
995903634 5:117097270-117097292 ATGTTTTTGCATCTTCCTCATGG - Intergenic
998265821 5:140667023-140667045 CTGTATTTTCATCTTTGAAAGGG + Intronic
998714153 5:144863343-144863365 TTCTATTTGCATCTTGTTAATGG - Intergenic
1000639344 5:163683131-163683153 CTGCATTTTAATCTTGGTTAAGG - Intergenic
1003873948 6:10421006-10421028 CTGCCTTAGAATCTTGGTCAAGG + Intergenic
1004071943 6:12307038-12307060 CTGTATTTTCAATTTTGTCATGG + Intergenic
1004842054 6:19598638-19598660 TTGTATTGGCATCTGGATCATGG + Intergenic
1005741925 6:28799946-28799968 CTTTAATTTCATTTTGGTCAGGG - Intergenic
1007996144 6:46310000-46310022 CTAAATTTGCACCTTTGTCATGG + Intronic
1009928917 6:70153137-70153159 CTGTATTTGGATTTTGTTCGGGG - Intronic
1010317663 6:74469071-74469093 CTGTATTGGCATCTTTGTTCTGG + Intergenic
1014128982 6:117810110-117810132 CTGTTTTTTCATCTTCTTCATGG + Intergenic
1014415045 6:121173434-121173456 TTTTATTTTCATATTGGTCAGGG - Intronic
1014736546 6:125100988-125101010 CTGTATGTGGATCTTGGTGAAGG + Intergenic
1014906428 6:127035003-127035025 CTGCATTTGCATCTTGAGCTTGG + Intergenic
1015734160 6:136379920-136379942 CTCTGTCTCCATCTTGGTCAAGG - Intronic
1016846587 6:148574117-148574139 TTCTATTTGCATCTTTGTGAAGG - Intergenic
1024171291 7:46790787-46790809 CTTTTTTTGCTTCTTAGTCAGGG - Intergenic
1025219781 7:57097321-57097343 ATGTATTTGTATCTAGGTCTTGG - Intergenic
1028962660 7:96766901-96766923 CTGTATGTGTATGTTGGGCAGGG - Intergenic
1030586511 7:111426512-111426534 TTTTATTTGCATCCTGGTCTAGG - Intronic
1031683530 7:124704244-124704266 CTGCATTTGCATGTTTATCACGG - Intergenic
1032543285 7:132722006-132722028 ATTTATTTGCAACTTGGCCATGG - Intronic
1033109756 7:138563529-138563551 CCTTTTTTGCCTCTTGGTCACGG + Intronic
1033217195 7:139501690-139501712 CTGTATTTTCATTTTGATTAGGG - Intergenic
1036651633 8:10647793-10647815 CTGTTTGTACATCTTGTTCATGG - Intronic
1038796107 8:30711342-30711364 CTGTTTTTTCCTCTTTGTCAAGG + Intronic
1039496749 8:37986179-37986201 CTGTATTTCCCTGGTGGTCATGG - Intergenic
1041510069 8:58646174-58646196 CTGTAATTGATTCTTGTTCATGG - Intronic
1042109801 8:65368355-65368377 CTGAATTTCCATTTTGGTTAGGG - Intergenic
1042203004 8:66299911-66299933 CTGAAAATGCATCTTGATCATGG + Intergenic
1044641846 8:94390808-94390830 GAATATTTGCATCTTGGGCATGG + Intronic
1045260316 8:100567377-100567399 CTGTATTTGGGTCCTGATCAGGG - Intergenic
1048034945 8:130668761-130668783 CTGTCTTTCCATCTAGGTCTTGG + Intergenic
1048436775 8:134425587-134425609 CTGAATGTGCATCTGGGACATGG + Intergenic
1049950768 9:641488-641510 CTCCATTTGCATGTTGTTCATGG - Intronic
1050295332 9:4198147-4198169 CTGAATTTCCATTTTGGTTAGGG - Intronic
1050353255 9:4760295-4760317 CTGTAAGTTCAGCTTGGTCAAGG + Intergenic
1051920176 9:22256130-22256152 CTGAATTTCCATTTTGGTTAGGG + Intergenic
1055027739 9:71740287-71740309 CTGTAATAACATCTTTGTCAGGG - Intronic
1056110573 9:83390488-83390510 CTGTCTTTGGATCTTAGTCCTGG - Intronic
1057569262 9:96191527-96191549 CTGCATTTGCATTTTGTTCCTGG - Intergenic
1057915047 9:99048886-99048908 CTGTGTTTACATCTTGGTTTGGG - Intronic
1061276638 9:129572534-129572556 CTTTCTTTGCATGTTGGTCCTGG - Intergenic
1061390455 9:130314819-130314841 CTCTATTTTCACCTTGGTCCTGG - Intronic
1185823324 X:3225721-3225743 CTTTATTTGCATGTTGCCCATGG + Intergenic
1186405309 X:9296582-9296604 CTGTAATTCCTGCTTGGTCAAGG + Intergenic
1186635069 X:11394893-11394915 CTGCATTTTCATTTTGATCAGGG - Intronic
1187753708 X:22496518-22496540 AGATATTTGAATCTTGGTCAGGG + Intergenic
1187900973 X:24026008-24026030 GTCTTTTTGCATCTTGGCCACGG + Intronic
1189215310 X:39318073-39318095 CTGCAGTCGCATCATGGTCATGG + Intergenic
1193774641 X:85627218-85627240 CTGAATTTCCATTTTGGTTAAGG + Intergenic
1194333357 X:92614135-92614157 CTGCATTTACATTTTGGTTAAGG + Intronic
1195901648 X:109803945-109803967 ATGTATTTCCATTTTGCTCATGG - Intergenic
1197015093 X:121615078-121615100 CTGTATGTTCATCTTGGTGATGG - Intergenic
1198443498 X:136688119-136688141 CTGTATTTTAATTGTGGTCATGG + Intronic
1198593172 X:138207026-138207048 CTGTGTTTGCATATTGGTGGTGG + Intergenic
1199409765 X:147507815-147507837 CTGTATGTGTAGCTTGTTCATGG + Intergenic
1200107165 X:153721032-153721054 CTGGATTTCCATTTTGCTCAGGG - Intronic
1200642041 Y:5733143-5733165 CTGCATTTACATTTTGGTTAAGG + Intronic