ID: 936733586

View in Genome Browser
Species Human (GRCh38)
Location 2:115412774-115412796
Sequence AACCTTTAACTCTTACTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936733586 Original CRISPR AACCTTTAACTCTTACTGAG AGG Intronic
901539277 1:9904766-9904788 AAGCTTTAACTCACACAGAGAGG + Intronic
902747883 1:18485210-18485232 AACCTTCAACCCCTAGTGAGGGG + Exonic
907260244 1:53212496-53212518 AACCTTTTTCTATTACTGATTGG + Intronic
910461121 1:87448882-87448904 CATTTTTAACTATTACTGAGTGG - Intergenic
914318359 1:146535217-146535239 CATTTTTAACTATTACTGAGTGG - Intergenic
914496001 1:148198140-148198162 CATTTTTAACTATTACTGAGTGG + Intergenic
916340209 1:163725205-163725227 ATCTTTCAACTCTTACTCAGTGG + Intergenic
919177881 1:194042460-194042482 AACCTTTAACTCTTACTCTCTGG - Intergenic
919911788 1:202115647-202115669 ACCCCTTACCTTTTACTGAGGGG + Intergenic
920863847 1:209734964-209734986 ACTCTTTATCTCTTCCTGAGTGG + Intergenic
1064613036 10:17123768-17123790 TACATTTAACTCTTAATCAGTGG + Intronic
1074834099 10:117272613-117272635 AACCTATAATTCTTACTGTTTGG - Intronic
1074902304 10:117829172-117829194 AACCTTTAAAGCAGACTGAGAGG - Intergenic
1080435781 11:32242042-32242064 AACATTTTACTCATTCTGAGGGG - Intergenic
1089895319 11:121924919-121924941 AACAATTAATTCTTACTGTGGGG - Intergenic
1097454285 12:59777514-59777536 AAGCTTCAATTCTTTCTGAGAGG - Intronic
1099197789 12:79639668-79639690 AACTTTTAATTTTTAGTGAGAGG - Intronic
1099473850 12:83083952-83083974 GACTTTTAACTCTTGCTGAATGG + Intronic
1099716310 12:86296951-86296973 AACCTTTGGCTGTTACTGAGAGG - Intronic
1101392991 12:104319980-104320002 ACCCTTTAACACTTGCAGAGTGG + Intronic
1102617272 12:114165564-114165586 AACCTTTAACTCTTTCCAGGGGG - Intergenic
1103023312 12:117554143-117554165 AACCTTTGCCTCCTACTGTGAGG + Intronic
1104409980 12:128549889-128549911 CACCTCCAGCTCTTACTGAGTGG - Intronic
1107818857 13:44268135-44268157 AATGTTGAATTCTTACTGAGCGG - Intergenic
1108237996 13:48428918-48428940 ATCTTTTACCTATTACTGAGGGG + Intronic
1113701181 13:112389845-112389867 AATCTTTAGCCCTTATTGAGTGG - Intronic
1118152256 14:63202139-63202161 ATCCTTTACCTCTAACTGAAAGG - Intergenic
1121307151 14:92913872-92913894 TAGCTTTACCTCTTACTGACTGG - Intergenic
1121713305 14:96054909-96054931 AACCTTTGACTCATTCTGAGAGG + Intronic
1124061411 15:26296972-26296994 AACTGTTAACTCTCACTGTGAGG - Intergenic
1128791950 15:70440267-70440289 GACCTTTAAAGCTTACTGGGAGG - Intergenic
1129080117 15:73032223-73032245 CACCTTTAACTCTTAGAGACAGG - Intergenic
1129405209 15:75312451-75312473 AACCTTTATGACTTCCTGAGAGG - Intergenic
1130407457 15:83614511-83614533 AACCTTTAACGCTTCCTTAGGGG + Intronic
1131876497 15:96812441-96812463 AAATTTTATCTCTTACTGTGTGG + Intergenic
1140876085 16:79153698-79153720 AACCTTTAAATGGTACTGGGAGG - Intronic
1143826429 17:9611885-9611907 AACCTTTTACTCTTTCAGATAGG + Intronic
1145951108 17:28818146-28818168 AACCTTGAACTCTTACTCCTGGG - Intronic
1149550887 17:57538520-57538542 ATCATTTAACTCTTACAGAGCGG - Intronic
1150578337 17:66450127-66450149 GATCGTTAACTCATACTGAGTGG + Intronic
1150984442 17:70179697-70179719 AAGCTTTTGCTTTTACTGAGTGG - Exonic
1151091390 17:71444078-71444100 ACCCTTTAACTTTTCCTGATAGG - Intergenic
1153004318 18:483580-483602 AAGCTTTAATTCTTTCTGAATGG + Intronic
1157076361 18:44471914-44471936 AATCATTAACACTTCCTGAGTGG + Intergenic
1159354408 18:67319063-67319085 AACCTTTAATTGTTTCTGACTGG - Intergenic
1159585063 18:70276004-70276026 AACCTAAAAATCTTTCTGAGTGG + Intergenic
1160221891 18:76984082-76984104 AACCCTTAACTCTTAGACAGCGG - Intronic
1161568790 19:5018554-5018576 AAAAGTTAACTTTTACTGAGAGG + Intronic
933611655 2:84442976-84442998 ACCCCTTAATTCTTCCTGAGTGG - Intronic
936733586 2:115412774-115412796 AACCTTTAACTCTTACTGAGAGG + Intronic
936863228 2:117047221-117047243 CACCTTTACTTCTTCCTGAGGGG - Intergenic
939539364 2:143474646-143474668 AACCTTTATTTCTTACTACGTGG + Intronic
941314460 2:163975340-163975362 AGACTTTAACTCTGACTGAAAGG + Intergenic
941740596 2:169031162-169031184 TCCCTTTAACTCTTACTTTGTGG - Intronic
948859124 2:240744396-240744418 AACCCATAACTCTTGCTGAGTGG - Intronic
1170007210 20:11682423-11682445 AACCTAAAATTCTTACTGTGTGG - Intergenic
1170967680 20:21090279-21090301 AACATTTAAATCTTAATGACTGG + Intergenic
1171988350 20:31676438-31676460 AACATTTAACTGTTCCTGGGTGG + Intronic
1174662993 20:52231072-52231094 AAGCTTTAACACTCATTGAGAGG + Intergenic
1176970337 21:15257909-15257931 AACCTGTGACTATTACTGGGGGG + Intergenic
1179067869 21:38043298-38043320 AACCAAAAACTCTTGCTGAGTGG + Intronic
1179965209 21:44800682-44800704 AAACATCAACTCTTACTGGGCGG + Intronic
952071250 3:29638985-29639007 AACTTTTAACTCTTAAAGAAAGG - Intronic
955772616 3:62401092-62401114 AACCTGCAAGTCTTGCTGAGAGG + Intronic
955812024 3:62801123-62801145 AACCTTGAAGAATTACTGAGAGG + Intronic
956179406 3:66503094-66503116 AAACTTAAACACTGACTGAGAGG - Intergenic
958010930 3:87878771-87878793 AACATATAACTTTTACTTAGTGG - Intergenic
958068363 3:88575493-88575515 AACCATTAACTTATCCTGAGAGG + Intergenic
959914630 3:111802859-111802881 AACCTTTAACTTTTCCTGACAGG - Intronic
963328002 3:143883067-143883089 AAACTGTAAATCTTACTAAGAGG - Intergenic
963621559 3:147613958-147613980 ACCCTTGAACTCTGACAGAGAGG + Intergenic
970782034 4:19749186-19749208 AGCCTTAAACTCACACTGAGCGG + Intergenic
971869101 4:32212637-32212659 AACCTTTACCTCTTGTTGAAAGG - Intergenic
972037383 4:34543300-34543322 AACCTGTAATTCCTTCTGAGTGG + Intergenic
973004685 4:44992535-44992557 ATCCTTTAAGTCTTACAGACTGG - Intergenic
974142296 4:57902653-57902675 TACCATTAACTCATACAGAGTGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978169743 4:105655495-105655517 AACCCTTAATTATCACTGAGAGG - Intronic
978892084 4:113841867-113841889 AACCTTTTACTCTTCATAAGTGG - Intergenic
980827164 4:138087818-138087840 AACTTTTAACACTCACTGTGAGG - Intergenic
983736922 4:171073192-171073214 AAGCTGTAACTCTCACTGCGAGG - Intergenic
997245507 5:132345077-132345099 AACCTTTAGAACTTCCTGAGTGG - Intergenic
999481730 5:151954544-151954566 AACCTTTCACTGTGAATGAGGGG - Intergenic
1005202085 6:23358763-23358785 AACATTCAACTCTAACTGATTGG - Intergenic
1009558784 6:65211134-65211156 AACCTATTACTCTTACAGATGGG + Intronic
1012418883 6:99039878-99039900 AACCTTTAACTCTCAAAGTGTGG - Intergenic
1013090445 6:106895775-106895797 AACCTTTTACGCTTACTGATTGG + Intergenic
1018080407 6:160254919-160254941 AATCTTTAACCCTTGCTCAGTGG - Intronic
1018440805 6:163811162-163811184 AACCTTTAACTATGACTGTGAGG - Intergenic
1021543289 7:21784570-21784592 AACCTTTAAATATTACTTTGAGG - Intronic
1022285264 7:28950696-28950718 AAATGTTAACTATTACTGAGTGG + Intergenic
1022418875 7:30201825-30201847 AATCTTTTGCTCTGACTGAGAGG + Intergenic
1022828307 7:34039214-34039236 AAGCTTTAAGTCTTACTTACTGG + Intronic
1025600188 7:62986915-62986937 AACCTTAAACTCTGACTGCCAGG - Intergenic
1025970316 7:66317856-66317878 AACCTTTAAATATTACTGTCAGG + Intronic
1033576999 7:142695075-142695097 AAACTTTAATTCCCACTGAGGGG + Intergenic
1037944651 8:22981264-22981286 AACATTTCACTTTTACTGGGTGG - Intronic
1039255430 8:35713762-35713784 AACTTTTCACCCTCACTGAGAGG - Intronic
1042312764 8:67395273-67395295 AACCTTCAACTCTTAAGGACAGG + Intergenic
1044052132 8:87518515-87518537 AAACTTTCACTCTTAATGAAAGG - Intronic
1044884511 8:96762450-96762472 AACCAGTAACTTTTATTGAGAGG - Intronic
1053056494 9:34996137-34996159 AACCTTTAAATCCCACAGAGAGG - Intronic
1054738292 9:68779057-68779079 AACTTTTAATTCTTACTGAGGGG - Intronic
1056119139 9:83470026-83470048 AACCATTAAATCTGGCTGAGAGG + Intronic
1057541933 9:95982571-95982593 AGCATGTAACTCTTACTGGGTGG + Intronic
1060083726 9:120677838-120677860 AACAATTAACTCTTACTAAGTGG - Intronic
1060158850 9:121341131-121341153 AGCCTTTAACTCATAAAGAGAGG - Exonic
1061963522 9:134000083-134000105 AAACTTTGGCTCTTACTGAAAGG + Intergenic
1186023964 X:5288270-5288292 AACCTGTAACACTCACTGCGAGG - Intergenic
1189377433 X:40476397-40476419 AACCTTCTAGTCTGACTGAGGGG - Intergenic
1191879323 X:65828657-65828679 AACCTTAGACTCTTCTTGAGTGG - Intergenic
1191891067 X:65941618-65941640 AATCTTTAACTATTACTGTATGG + Intergenic
1193139486 X:78011857-78011879 AAACTTGAACTCTTTCTTAGGGG - Intronic
1199095260 X:143730914-143730936 AAGCTTTAAATGTTACTGTGTGG - Intergenic
1202345834 Y:23925434-23925456 AACTTTTAACTCCCATTGAGTGG - Intergenic
1202524937 Y:25744656-25744678 AACTTTTAACTCCCATTGAGTGG + Intergenic