ID: 936739924

View in Genome Browser
Species Human (GRCh38)
Location 2:115492527-115492549
Sequence ATTTATGAGCCTTAGATGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1224
Summary {0: 1, 1: 0, 2: 1, 3: 69, 4: 1153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936739924 Original CRISPR ATTTATGAGCCTTAGATGGG CGG Intronic
900153657 1:1194045-1194067 ATTTAGGGGGCTGAGATGGGAGG + Intronic
900191390 1:1353724-1353746 ATTTCTGAGCCTGAGGTGGCAGG + Intronic
900976967 1:6023879-6023901 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
901349491 1:8580943-8580965 CTTTGGGAGCCTGAGATGGGAGG - Intronic
901471279 1:9458241-9458263 ATTTAAGAGGCTGAGGTGGGAGG - Intergenic
901591742 1:10350045-10350067 CTTTAGGAGGCTGAGATGGGCGG + Intronic
902068595 1:13712113-13712135 ATTTAGGAGGCTGAGGTGGGAGG + Intronic
902230760 1:15026047-15026069 ATTTATGGTCCTGGGATGGGCGG - Intronic
902601454 1:17542203-17542225 CTTTAGGAGCCTCAGGTGGGAGG + Intronic
902888390 1:19423631-19423653 ACTTAGGAGGCTGAGATGGGAGG - Intronic
902911676 1:19603010-19603032 ATTTATGAGCCCTACAGGTGTGG + Intronic
903101760 1:21035905-21035927 TTTTATGGGCCTTACAGGGGAGG - Intronic
903311880 1:22465384-22465406 TTTTATGGGCCTCAGAGGGGAGG + Intronic
903796167 1:25930400-25930422 AATTATGACACATAGATGGGAGG - Intergenic
903989921 1:27259926-27259948 ATTCAGGAGGCTGAGATGGGAGG + Intronic
904088542 1:27928463-27928485 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
904149244 1:28423298-28423320 ATTTAAGTGGCTGAGATGGGAGG + Intronic
904443802 1:30551216-30551238 TTTTCTGGGCCTCAGATGGGAGG - Intergenic
904518721 1:31077471-31077493 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
904522429 1:31105891-31105913 ATTTGTGGGGCTGAGATGGGAGG + Intergenic
904552994 1:31336771-31336793 ACTTAGGAGGCTGAGATGGGAGG - Intronic
904586194 1:31582217-31582239 ATTTAGGAGGCTGAGGTGGGAGG + Intronic
904740325 1:32670111-32670133 CTTTAGGAGGCTGAGATGGGTGG + Intronic
905084050 1:35354038-35354060 ATTTGGGAGGCTGAGATGGGAGG + Intronic
905557151 1:38895693-38895715 ATTTAGGAGGCTGAGGTGGGAGG + Intronic
905588303 1:39139498-39139520 ATTTGGGAGGCTGAGATGGGAGG - Intronic
905722240 1:40214812-40214834 ATTCATGAGACTGAGGTGGGAGG + Intronic
905838191 1:41149032-41149054 ATTTAGGAGGCTGAGGTGGGCGG - Intronic
906082404 1:43101970-43101992 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
906448247 1:45922161-45922183 TTTTATGGGCCTCAGAGGGGAGG + Intronic
907029080 1:51153077-51153099 ACTTAAGAGGCTGAGATGGGAGG - Intergenic
907039417 1:51245259-51245281 ATTCAGGAGACTGAGATGGGAGG - Intronic
907122081 1:52016824-52016846 ATTTAGGAGGCTGAGATGGGAGG + Intergenic
907136732 1:52146002-52146024 ATTTTTGAGCCTTGGCTGGGAGG - Intronic
907369625 1:53992536-53992558 TTTTATGTGCCTCAGAGGGGAGG + Intergenic
907608466 1:55843332-55843354 TTCTATGGGCCTTAGATAGGTGG + Intergenic
908229762 1:62092132-62092154 TTTTAGGAGGCTGAGATGGGAGG + Intronic
908280265 1:62526182-62526204 ATTTAGGAGACTGAGGTGGGAGG - Intronic
908515892 1:64892526-64892548 ATTTGGGAGGCTGAGATGGGAGG - Intronic
908538230 1:65098575-65098597 ATTTGGGAGGCTTAGGTGGGAGG - Intergenic
908550318 1:65202152-65202174 ATTTAGGAGGCTGAGATGGGTGG + Intronic
908598403 1:65712100-65712122 ACTTGGGAGCCTGAGATGGGAGG - Intergenic
908766628 1:67560142-67560164 CTTTGTGAGGCTGAGATGGGTGG + Intergenic
908832425 1:68192634-68192656 ATTCATGAGGCTGAGGTGGGAGG + Intronic
909061898 1:70888663-70888685 ATTTAAAAGCCTGAGATGGGAGG - Intronic
909228730 1:73059030-73059052 ACTTCTGAGCCTGTGATGGGAGG + Intergenic
909444973 1:75738686-75738708 TTTTGTGAGGCTGAGATGGGAGG - Intronic
909446264 1:75752089-75752111 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
910654946 1:89609933-89609955 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
910983505 1:92981996-92982018 ACTTATGAGGCTGAGATGGGAGG - Intergenic
911025033 1:93427027-93427049 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
911615149 1:100002723-100002745 ATTCAGGAGGCTGAGATGGGAGG - Intronic
911857029 1:102891629-102891651 ATTTGAGAGCCTGAGGTGGGAGG + Intronic
912045545 1:105450571-105450593 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
912283152 1:108339038-108339060 CTTTGAGAGGCTTAGATGGGAGG + Intergenic
912942984 1:114061277-114061299 TTTTATGAGCCTCAGTGGGGAGG - Intergenic
913273415 1:117116340-117116362 ATTCAGGAGGCTGAGATGGGAGG - Intronic
913370218 1:118090638-118090660 CTTTAGGAGGCTTAGGTGGGAGG + Intronic
913940955 1:125104635-125104657 ATTTATGACCTTTAGATGATGGG - Intergenic
914359489 1:146920696-146920718 ATTTCTGAAGCTTATATGGGAGG + Intergenic
914494261 1:148179179-148179201 ATTTCTGAAGCTTATATGGGAGG - Intergenic
914862337 1:151397213-151397235 CTTTGGGAGACTTAGATGGGCGG - Intergenic
915106778 1:153539790-153539812 ATTGAGGAGCCTTCGATGGTGGG - Intronic
915152595 1:153846479-153846501 CTTTAGGAGGCTGAGATGGGAGG - Intronic
916096290 1:161354092-161354114 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
916941208 1:169680563-169680585 TTTTAAAAGCCTTAGATGTGGGG + Intronic
917412541 1:174774769-174774791 ATTTGGGAGGCTGAGATGGGAGG + Intronic
917943436 1:179946085-179946107 ATTCAGGAGGCTGAGATGGGAGG + Intergenic
918023107 1:180714511-180714533 ATTCAGGAGGCTGAGATGGGAGG - Intronic
918081304 1:181209727-181209749 CTTTGGGAGCCTTAGGTGGGAGG - Intergenic
918212582 1:182364399-182364421 ACTTAGGAGGCTGAGATGGGAGG + Intergenic
918223643 1:182458576-182458598 ATTTGGGAGGCTTAGGTGGGAGG - Intronic
918355056 1:183700159-183700181 TTTTATGGGACTTAAATGGGTGG - Intronic
918486149 1:185030481-185030503 ATGGATGAACCTTAAATGGGTGG + Intergenic
918966530 1:191356958-191356980 ATTTATGAAGCTTAGTTTGGTGG + Intergenic
919798109 1:201333457-201333479 AGTTGGGAGCCTTAGCTGGGAGG - Intergenic
919891253 1:201976783-201976805 CTTTAGGAGGCTGAGATGGGTGG + Intergenic
920012048 1:202875424-202875446 ATTTATCATCCTTAGAAGTGAGG + Intergenic
920399147 1:205666397-205666419 ACTTAAGAGGCTGAGATGGGAGG + Intronic
920428247 1:205896298-205896320 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
920501646 1:206489146-206489168 AGTCAGGAGCCTGAGATGGGAGG - Intronic
921034015 1:211359197-211359219 ATTTGGGAGGCTGAGATGGGAGG - Intronic
921247051 1:213255215-213255237 ACTTAGGAGGCTGAGATGGGAGG + Intronic
921705955 1:218323438-218323460 TTTTATGGGCCTTAGAGGAGAGG + Intronic
921828020 1:219695693-219695715 ACTCAGGAGCCTGAGATGGGAGG + Intronic
921852648 1:219947422-219947444 ACTTAAGAGGCTGAGATGGGAGG + Intronic
922117789 1:222631228-222631250 ACTTAGGAGGCTGAGATGGGAGG - Intronic
922132762 1:222795607-222795629 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
922138985 1:222862639-222862661 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
922300602 1:224296020-224296042 ATTTGGGAGGCTTAAATGGGAGG + Intronic
923391377 1:233516267-233516289 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
923755295 1:236785960-236785982 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
924124283 1:240834028-240834050 CTTTAGGAGGCTGAGATGGGAGG - Intronic
924234960 1:241992930-241992952 CTTTAGGAGGCTAAGATGGGTGG + Intergenic
924486014 1:244485422-244485444 CTTTGTGAGGCTTAGGTGGGTGG - Intronic
924664793 1:246060177-246060199 ACTTAGGAGGCTGAGATGGGAGG + Intronic
924712953 1:246545702-246545724 ACTTAGGAGGCTCAGATGGGAGG + Intronic
1062770025 10:92018-92040 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1062771425 10:104658-104680 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1062798950 10:365287-365309 CTTTAGGAGGCTAAGATGGGAGG + Intronic
1063232814 10:4082606-4082628 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
1063263304 10:4415179-4415201 ATTTGTGAGGCTGAGATGGGAGG - Intergenic
1063540784 10:6931769-6931791 CTTTAGGAGGCTGAGATGGGAGG + Intergenic
1063970009 10:11375076-11375098 ACTTAGGAGGCTGAGATGGGAGG + Intergenic
1064024335 10:11834861-11834883 CTTTGTGAGGCTGAGATGGGTGG + Intronic
1064222539 10:13454360-13454382 CTTTATGAGGCTAAGGTGGGGGG + Intronic
1064425730 10:15227489-15227511 ATTTGGGAGGCTGAGATGGGAGG - Intronic
1065291350 10:24233014-24233036 ACTTAGGAGGCTGAGATGGGAGG + Intronic
1065379988 10:25080380-25080402 ATTTGTGAGCCCGAGGTGGGTGG - Intergenic
1065513727 10:26504997-26505019 CTTTGTGAGGCTGAGATGGGTGG - Intronic
1065576745 10:27128490-27128512 CTTTGTGAGGCTGAGATGGGAGG + Intronic
1065698932 10:28405863-28405885 ATTCAGGAGGCTGAGATGGGGGG - Intergenic
1065778706 10:29146364-29146386 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1065805603 10:29391115-29391137 ATTTAGGAGGCTGAGGTGGGAGG - Intergenic
1065943398 10:30585111-30585133 CTTTAGGAGGCCTAGATGGGTGG - Intergenic
1066272660 10:33838407-33838429 ACTTAGGAGGCTGAGATGGGAGG + Intergenic
1066272956 10:33841332-33841354 GTTTAGGAGGCTGAGATGGGAGG - Intergenic
1066475823 10:35746555-35746577 ATTTTGGAGGCTGAGATGGGAGG + Intergenic
1066560438 10:36664151-36664173 ATTTGGGAGGCTGAGATGGGTGG + Intergenic
1066574869 10:36814354-36814376 CTTTGTGAGGCTGAGATGGGCGG + Intergenic
1066640832 10:37552574-37552596 ATTTAGGAGGCTAAGGTGGGAGG + Intergenic
1067124328 10:43502920-43502942 ATTCAAGAGGCTGAGATGGGAGG + Intergenic
1067376800 10:45734827-45734849 ATTCAGGAGGCTGAGATGGGAGG - Intronic
1067401041 10:45973750-45973772 ACTTAGGAGGCTTAGAGGGGAGG - Intronic
1067675081 10:48367255-48367277 ATTCAGGAGGCTGAGATGGGAGG + Intronic
1067722248 10:48737116-48737138 ACTTAGGAGCCTGAGGTGGGAGG - Intronic
1067869396 10:49943322-49943344 ACTTAGGAGGCTTAGAGGGGAGG - Intronic
1067884494 10:50075512-50075534 ATTCAGGAGGCTGAGATGGGAGG - Intronic
1068450017 10:57174196-57174218 ATTGAGGAGGCTGAGATGGGAGG - Intergenic
1068530333 10:58178995-58179017 ACTTGTGAGGCTGAGATGGGAGG - Intergenic
1068591289 10:58855605-58855627 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1069249107 10:66245918-66245940 TTTTATGGGCCTCAAATGGGAGG + Intronic
1069434989 10:68372798-68372820 ACTCAGGAGCCTGAGATGGGAGG + Intronic
1069472626 10:68706396-68706418 ATTTGGGAGGCTGAGATGGGAGG + Intergenic
1069575982 10:69528850-69528872 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1069937481 10:71927851-71927873 ACTCAGGAGCCTGAGATGGGAGG - Intergenic
1070189780 10:74101375-74101397 ATTTGTGAGGCTGAGGTGGGAGG + Intronic
1070629898 10:78077061-78077083 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
1071235661 10:83645288-83645310 ATTTAGGAGGCTAAGGTGGGAGG + Intergenic
1071580598 10:86766093-86766115 ATTCAGGAGGCTGAGATGGGAGG - Intronic
1071827611 10:89340734-89340756 ATTTATGACCCTTGGCAGGGAGG - Exonic
1071957092 10:90770972-90770994 TTTTATGGGCCTCAGATGGGAGG - Intronic
1072071358 10:91920962-91920984 ACTCATGAGGCTGAGATGGGAGG + Intergenic
1072112518 10:92336687-92336709 ACTCAAGAGGCTTAGATGGGAGG + Intronic
1072297843 10:94028703-94028725 ATTTGGGAGGCTAAGATGGGAGG + Intronic
1072335586 10:94395453-94395475 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1072689937 10:97565819-97565841 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
1072720245 10:97775946-97775968 ATTCAGGAGCCTGAGGTGGGAGG + Intergenic
1072944811 10:99800089-99800111 ATTTAGGAGGCTGAGGTGGGAGG + Intronic
1073455113 10:103632056-103632078 ACTTATGAGCCTGAGGTGAGAGG + Intronic
1073737242 10:106363191-106363213 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
1074016089 10:109535560-109535582 ACTTAGGAGACTGAGATGGGAGG + Intergenic
1074052698 10:109894420-109894442 ATTTAGGAGGCTGAGGTGGGAGG + Intronic
1074172127 10:110951899-110951921 ATTTAAGAGCCTGAGGCGGGCGG - Intronic
1074247934 10:111713667-111713689 TTTTATGAGCCTCAGACGGGAGG + Intergenic
1074310762 10:112321270-112321292 CTTTAGGAGCCCAAGATGGGCGG + Intergenic
1074319985 10:112392804-112392826 ATTCAGGAGCCTGAGGTGGGAGG + Intronic
1074588694 10:114792210-114792232 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
1074706993 10:116141825-116141847 ATTTGGGAGGCTGAGATGGGTGG - Intronic
1074776741 10:116772801-116772823 ACTTAGGAGCCTAAGTTGGGAGG - Intergenic
1075007812 10:118842942-118842964 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
1075125249 10:119694145-119694167 CTTTAGGAGGCTGAGATGGGCGG + Intergenic
1075251349 10:120877508-120877530 ATTTGGGAGCCTGAGGTGGGAGG + Intronic
1076208380 10:128621744-128621766 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1076292390 10:129356477-129356499 ACTTGGGAGCCTGAGATGGGAGG + Intergenic
1076549132 10:131266905-131266927 TTTTATGGGCCTCAGAGGGGAGG + Intronic
1076655131 10:132019027-132019049 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1076679851 10:132166078-132166100 CTTTAGGAGGCCTAGATGGGAGG + Intronic
1076707947 10:132312113-132312135 ACTCAGGAGCCTGAGATGGGAGG - Intronic
1077012820 11:386362-386384 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
1077087358 11:760662-760684 ATTTGGGAGGCTGAGATGGGAGG + Intronic
1077162559 11:1120377-1120399 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1077838152 11:5943238-5943260 ATTTCTGAGGATTACATGGGAGG - Intergenic
1078096473 11:8300446-8300468 AATTATGAGCTTCAGACGGGAGG - Intergenic
1078107919 11:8370304-8370326 ATTTAGGAGGCTGAGGTGGGAGG - Intergenic
1079224655 11:18595038-18595060 ATACATGAGCATTAGATGAGGGG + Intergenic
1079690645 11:23412790-23412812 ATTTAAGAGGCTGAGATGGGCGG - Intergenic
1079710710 11:23679924-23679946 TTTTATGGGCCTCAGAAGGGAGG + Intergenic
1079949757 11:26786114-26786136 ATTTATGAGGCTGAGGTGGGAGG - Intergenic
1079982471 11:27165584-27165606 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
1080062815 11:27974985-27975007 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1080071653 11:28095900-28095922 ATTCAGGAGGCTAAGATGGGAGG + Intronic
1080285788 11:30609814-30609836 CTTTGGGAGCCTGAGATGGGAGG - Intergenic
1080361136 11:31515554-31515576 ATTTCAGAGGCTGAGATGGGAGG + Intronic
1080462545 11:32468235-32468257 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
1080535868 11:33221050-33221072 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
1080632348 11:34089521-34089543 CTTTAGGAGGCTGAGATGGGAGG + Intronic
1080851966 11:36078128-36078150 TTTTATGAGCCTCAGAGGGGAGG + Intronic
1080928355 11:36782184-36782206 ATTCAGGAGGCTGAGATGGGAGG + Intergenic
1081202508 11:40234660-40234682 AGTTAGGAGGCTGAGATGGGAGG + Intronic
1081920343 11:46769450-46769472 CTTTAGGAGACTGAGATGGGAGG + Intronic
1081932301 11:46880229-46880251 ACTCAGGAGCCTCAGATGGGAGG + Intronic
1082177559 11:49078912-49078934 CTTTTGGAGCCTAAGATGGGAGG - Intergenic
1082819423 11:57534499-57534521 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
1082853338 11:57784747-57784769 CTTTAGGAGGCTGAGATGGGAGG - Intronic
1083066773 11:59932024-59932046 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1083250190 11:61461640-61461662 ATTTGGGAGGCTGAGATGGGAGG - Intronic
1083350480 11:62024884-62024906 CTTTATGAGGCTGAGGTGGGTGG - Intergenic
1083599324 11:63937084-63937106 CTTTAGGAGGCTGAGATGGGCGG - Intergenic
1083704101 11:64501289-64501311 ATTTGTGAGGCTGAGGTGGGAGG - Intergenic
1083774923 11:64889828-64889850 ATTTGGGAGGCTGAGATGGGAGG + Intergenic
1083854266 11:65384819-65384841 ATTCAGGAGCCTGAGGTGGGAGG - Intergenic
1084017785 11:66396488-66396510 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
1084139291 11:67213969-67213991 ACTTGTGAGGCTAAGATGGGAGG - Intronic
1084443605 11:69190509-69190531 ATTTGGGAGGCTGAGATGGGAGG + Intergenic
1084782511 11:71419692-71419714 ATTTGGGAGCCTGAGGTGGGAGG - Intergenic
1084999173 11:73013854-73013876 CTTTAGGAGGCTAAGATGGGAGG - Intronic
1085083202 11:73650104-73650126 ATTTGGGAGGCTGAGATGGGAGG + Intronic
1085100589 11:73796753-73796775 TTTTATGAGCCTCAGAGGGAAGG - Intronic
1085131846 11:74046570-74046592 CTTTAGGAGGCTGAGATGGGAGG - Intronic
1085214312 11:74814632-74814654 CTTTGTGAGGCTGAGATGGGTGG - Intronic
1085500231 11:77014801-77014823 ATTTGGGAGACTGAGATGGGAGG + Intronic
1086189231 11:84058576-84058598 ATTTGAGAGGCTGAGATGGGAGG + Intronic
1086332931 11:85772009-85772031 GTTTAGGAGGCTGAGATGGGAGG - Intronic
1086451676 11:86923360-86923382 ATTTGGGAGGCTTAGGTGGGAGG - Intronic
1086459845 11:86995710-86995732 CTTTGGGAGGCTTAGATGGGTGG + Intergenic
1086478667 11:87208954-87208976 CTTTATGAAGCTTAGATTGGAGG - Intronic
1086547898 11:88019574-88019596 TTTTAAGAACTTTAGATGGGAGG - Intergenic
1087038558 11:93776779-93776801 CTTTAGGAGGCCTAGATGGGAGG - Intronic
1087440585 11:98178465-98178487 ATTTAGGAGGCTAAGAAGGGAGG - Intergenic
1087692680 11:101339943-101339965 ATTTGGGAGGCTGAGATGGGTGG - Intergenic
1088227313 11:107635356-107635378 ATTTCTGAGGCCAAGATGGGAGG - Intronic
1088470397 11:110183434-110183456 ATTTAGGAGACTGAGGTGGGAGG - Intronic
1088617346 11:111643872-111643894 ACTCATGAGGCTTAGGTGGGAGG + Intronic
1088826641 11:113500813-113500835 ATTCAGGAGGCTGAGATGGGAGG + Intergenic
1088923985 11:114282113-114282135 ACTCAGGAGCCTGAGATGGGAGG + Intronic
1089411463 11:118246691-118246713 ATTTGGGAGGCTGAGATGGGAGG - Intronic
1089548767 11:119253372-119253394 ATTCAGGAGGCTGAGATGGGAGG + Intronic
1089591904 11:119547017-119547039 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
1089711792 11:120320389-120320411 ACTGAAGAGCCTGAGATGGGAGG + Intergenic
1089920609 11:122206325-122206347 ATGTGTGAGCCTTACATGGCAGG + Intergenic
1090943641 11:131410375-131410397 ATTTAGGAGGCTGAGGTGGGAGG + Intronic
1090980136 11:131712824-131712846 ATTTGGGAGCCTGAGGTGGGTGG - Intronic
1091567166 12:1657444-1657466 ATTGAGGAGGCTGAGATGGGAGG - Intergenic
1091731076 12:2880880-2880902 CTTTAGGAGGCTGAGATGGGAGG - Intronic
1091895013 12:4095368-4095390 ACTTAGGAGCCTGAGGTGGGGGG + Intergenic
1092376419 12:7959384-7959406 CTTTAGGAGGCTGAGATGGGAGG + Intergenic
1092447091 12:8567962-8567984 TTTTATGGACCTCAGATGGGAGG + Intergenic
1092507683 12:9120987-9121009 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1092648864 12:10611501-10611523 ATTTGGGAGGCTGAGATGGGTGG + Intronic
1092806847 12:12231904-12231926 ACTTAGGAGGCTAAGATGGGAGG + Intronic
1092811234 12:12273140-12273162 ATGGATCAGCCTTGGATGGGAGG + Intergenic
1092867625 12:12778031-12778053 ATTCAGGAGCCTGAGGTGGGAGG - Intronic
1092886945 12:12932916-12932938 ATTTAAGAGGCTGAGGTGGGAGG + Intergenic
1093028406 12:14265825-14265847 ACTTGAGAGCCTTAGGTGGGAGG - Intergenic
1093170337 12:15852892-15852914 ATTCAGGAGGCTGAGATGGGAGG + Intronic
1093184604 12:16005335-16005357 ACTTAGGAGACTGAGATGGGAGG + Intronic
1093283759 12:17231157-17231179 CTTTAGGAGGCTTAGGTGGGTGG - Intergenic
1093919420 12:24843358-24843380 CTTTAGGAGCCTAAGATGGGCGG + Intronic
1093963047 12:25296375-25296397 ACTTGGGAGCCTGAGATGGGAGG - Intergenic
1094144946 12:27218984-27219006 TTTTAGGAGGCTGAGATGGGTGG - Intergenic
1095366345 12:41410985-41411007 ATTCGGGAGCCTGAGATGGGAGG - Intronic
1095815576 12:46418479-46418501 ATTTATGAAGCTTAGTTTGGTGG - Intergenic
1096081802 12:48838305-48838327 TTTTATGAGACCTAGATGGGAGG + Intronic
1096287496 12:50312997-50313019 ACTTGGGAGCCTGAGATGGGAGG + Intergenic
1097012532 12:55963631-55963653 TGTTAAGAGCCTTAGGTGGGTGG + Intronic
1097039895 12:56149615-56149637 ATTCAGGAGCCTGAGGTGGGAGG - Intergenic
1097129931 12:56804558-56804580 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1097207767 12:57338058-57338080 CTTTGTGAGGCTGAGATGGGCGG + Intronic
1097426406 12:59450310-59450332 ACTTAGGAGACTGAGATGGGAGG - Intergenic
1097446478 12:59678597-59678619 TTTTATGGGCTTCAGATGGGAGG + Intronic
1097500266 12:60392596-60392618 TTTTATGAACCTCAGAAGGGAGG - Intergenic
1097502890 12:60428054-60428076 ATTTGGGAGGCTTAGGTGGGAGG + Intergenic
1097572893 12:61356027-61356049 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1097877989 12:64661374-64661396 ATTCAGGAGGCTGAGATGGGAGG + Intronic
1097935809 12:65249955-65249977 AGTTAAGAGGCTGAGATGGGAGG + Intergenic
1097993318 12:65859838-65859860 TTTTGGGAGCCTGAGATGGGAGG + Exonic
1098341683 12:69458177-69458199 ACTTGTGAGGCTAAGATGGGAGG - Intergenic
1098527299 12:71500544-71500566 ACTTAGGAGGCTGAGATGGGAGG - Intronic
1098650896 12:72967003-72967025 ATTCATGAGGCTAAGGTGGGAGG - Intergenic
1098943996 12:76570157-76570179 ATTTGAGAGCCTGAGGTGGGAGG + Intergenic
1098958164 12:76709014-76709036 ACTTAGGAGGCTGAGATGGGAGG + Intergenic
1099272462 12:80527973-80527995 ATTCAGGAGACTGAGATGGGAGG + Intronic
1099430023 12:82571998-82572020 ACTTAGGAGGCTTAGGTGGGAGG + Intergenic
1099729824 12:86485967-86485989 CTTTATGAGGCTTAGTTTGGTGG - Intronic
1099926517 12:89025252-89025274 ACTTATGAGGCTGAGGTGGGAGG - Intergenic
1100077552 12:90803714-90803736 ATTTAGGAGGTTGAGATGGGAGG - Intergenic
1100178212 12:92054782-92054804 ATTCATGAGGCAGAGATGGGAGG + Intronic
1100316796 12:93452222-93452244 ATTCAGGAGGCTCAGATGGGAGG - Intergenic
1100322435 12:93508320-93508342 ATTTGGGAGGCTGAGATGGGAGG + Exonic
1100562193 12:95758671-95758693 ATTCAGGAGCCTGAGGTGGGAGG - Intronic
1100645689 12:96527809-96527831 CTTTAGGAGGCTGAGATGGGTGG - Intronic
1100769868 12:97910133-97910155 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
1100926404 12:99553369-99553391 ATTTAAGGTCCTTAGATGAGAGG + Intronic
1101147179 12:101852280-101852302 ATTTAGGAGGCTGAGATGGGAGG - Intergenic
1101491968 12:105217997-105218019 ATTCAGGAGGCTAAGATGGGAGG + Intronic
1101728368 12:107406319-107406341 ATTTGGGAGGCTGAGATGGGAGG + Intronic
1102144281 12:110643144-110643166 CTTTAGGAGGCTGAGATGGGAGG - Intronic
1102169305 12:110829843-110829865 CTTTAGGAGGCTGAGATGGGTGG + Intergenic
1102509823 12:113407264-113407286 CTTTAGGAGGCTGAGATGGGAGG - Intronic
1102699955 12:114830441-114830463 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1102857055 12:116303309-116303331 ACTTATGAGGCTGAGGTGGGAGG - Intergenic
1102919666 12:116782416-116782438 ATTTGGGAGCCCAAGATGGGAGG + Intronic
1103258462 12:119563872-119563894 CTTTATGAGGCTGAGGTGGGTGG + Intergenic
1103298469 12:119908146-119908168 ATGTGTGAACCTTAGATGGTAGG + Intergenic
1103357191 12:120330444-120330466 CTTTGGGAGGCTTAGATGGGAGG - Intergenic
1103360768 12:120352248-120352270 CTTTAAGAGCCTGAGATGGGAGG - Intronic
1103374895 12:120447995-120448017 CTTTAGGAGGCTGAGATGGGTGG - Intronic
1103382095 12:120501948-120501970 ATTTAAGAGGCTGAGGTGGGAGG + Intergenic
1103552175 12:121745791-121745813 ATTCATGAGGCTAAGGTGGGAGG - Intronic
1103574019 12:121863669-121863691 CTTTAAGAGGCTGAGATGGGGGG + Intergenic
1103657118 12:122480578-122480600 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
1103665113 12:122558004-122558026 ATTTGTGAGGCTGAGGTGGGTGG + Intronic
1104433482 12:128736171-128736193 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
1104513479 12:129402677-129402699 ACTTAGGAGGCTGAGATGGGAGG - Intronic
1104863454 12:131938198-131938220 CTTTATGAGACTGAGGTGGGAGG + Intronic
1104997537 12:132667972-132667994 ACTTAGGAGGCTGAGATGGGAGG + Intronic
1105471292 13:20697300-20697322 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
1106044720 13:26128321-26128343 CTTTAGGAGGCTGAGATGGGTGG + Intergenic
1106150406 13:27095044-27095066 ACTTATGAGGCTTAGATGGAAGG + Intronic
1106465248 13:30008000-30008022 CTTTAGGAGGCTGAGATGGGTGG + Intergenic
1106523825 13:30522345-30522367 CTTTAAGAGGCTGAGATGGGAGG - Intronic
1106822325 13:33478805-33478827 ATTCATGAGGCTGAGGTGGGAGG + Intergenic
1106916254 13:34518411-34518433 ATTTATAAGCATTTGTTGGGGGG - Intergenic
1107202342 13:37736835-37736857 ACTTGGGAGCCTGAGATGGGAGG - Intronic
1107471078 13:40691894-40691916 ATTTGTGAGGCTGAGATGGGAGG + Intergenic
1108060168 13:46525099-46525121 ATTTAGGAGGCTGAAATGGGAGG - Intergenic
1108623129 13:52203222-52203244 CTTTGGGAGGCTTAGATGGGAGG + Intergenic
1108956905 13:56169407-56169429 ATTTTTGAGAATTAGATGGGAGG + Intergenic
1109241447 13:59894578-59894600 ATTTATGTGCTTTTGAGGGGTGG - Intronic
1109633693 13:65085776-65085798 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1110293811 13:73839199-73839221 ACTTAGGAGCCTGAGATGGGAGG - Intronic
1110670254 13:78169251-78169273 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1110857716 13:80314604-80314626 ATTTGGGAGGCTGAGATGGGAGG + Intergenic
1111104227 13:83624776-83624798 ATTTTTGAGCCTGAGGAGGGGGG + Intergenic
1111265177 13:85801838-85801860 TATTATGAGGCTGAGATGGGAGG - Intergenic
1111337236 13:86840120-86840142 TTTTATGAGCCTCAGAGGAGAGG + Intergenic
1111512677 13:89287320-89287342 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1111842927 13:93473035-93473057 TTTTATGGGCCTCACATGGGAGG + Intronic
1112054890 13:95681457-95681479 ATTCAGGAGGCTGAGATGGGAGG - Intronic
1112547484 13:100385729-100385751 ATTCAGGAGCCTGAGGTGGGAGG - Intronic
1112740907 13:102472151-102472173 TTTTATGAACCTCAGAGGGGAGG + Intergenic
1112939936 13:104848785-104848807 ATTCAGGAGGCTTAGGTGGGAGG + Intergenic
1113954174 13:114088020-114088042 ATTTGTGAGGCTGAGGTGGGAGG + Intronic
1114168609 14:20248111-20248133 ATTTAAGAGGCTGAGATGGGAGG + Intergenic
1114259549 14:21026537-21026559 ATTGATGTTCCTTGGATGGGAGG - Intronic
1114349569 14:21835570-21835592 TTTTATGGGCCTCAGAAGGGAGG + Intergenic
1114416971 14:22551347-22551369 ACTTAAGAGGCTGAGATGGGAGG + Intergenic
1114882061 14:26798419-26798441 CTTTGGGAGGCTTAGATGGGAGG + Intergenic
1115034269 14:28838318-28838340 CTTTGGGAGCCTAAGATGGGAGG - Intergenic
1115038322 14:28888289-28888311 ACTTAGGAGACTAAGATGGGAGG - Intergenic
1115050829 14:29060628-29060650 ATTCAGGAGCCTGAGTTGGGAGG + Intergenic
1115279466 14:31645307-31645329 CTTTAGGAGGCTGAGATGGGCGG - Intronic
1115283123 14:31687002-31687024 ATTTGGGAGGCTGAGATGGGAGG + Intronic
1115408334 14:33044886-33044908 ATTTATCAGCCTCAGGTGAGTGG + Intronic
1115653737 14:35423039-35423061 ACTCATGAGGCTGAGATGGGAGG - Intergenic
1115678307 14:35706726-35706748 ACTTGGGAGCCTGAGATGGGAGG - Intronic
1115691169 14:35844987-35845009 ACTTACGAGCCTGAGGTGGGAGG - Intronic
1116629722 14:47314567-47314589 ACTTGTGAGGCTTAGGTGGGAGG + Intronic
1117143153 14:52810233-52810255 ATTTGGGAGGCCTAGATGGGCGG + Intergenic
1117914457 14:60662557-60662579 CTTTAGGAGGCTGAGATGGGAGG + Intergenic
1118212414 14:63777910-63777932 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1118386733 14:65261947-65261969 ATTTGTGAGGCTGAGGTGGGAGG - Intergenic
1118406514 14:65429617-65429639 ATTTTGGAGGCTGAGATGGGAGG + Intronic
1118406538 14:65429752-65429774 ATTTGTGAGGCTGAGTTGGGAGG + Intronic
1118575160 14:67234910-67234932 CTTTAGGAGGCTGAGATGGGTGG + Intergenic
1118609854 14:67531797-67531819 GTTCATGAGGCTGAGATGGGAGG + Intronic
1118750512 14:68804587-68804609 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1118787566 14:69058762-69058784 ACTCAGGAGCCTGAGATGGGAGG + Intronic
1119058856 14:71453370-71453392 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
1119673537 14:76537325-76537347 ATTTAGGAGGCTAAGGTGGGAGG + Intergenic
1119870016 14:78008956-78008978 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
1120605256 14:86568166-86568188 TTTTAGGAGACTGAGATGGGAGG - Intergenic
1120875794 14:89374153-89374175 ATTTAGGAGGCTGAGGTGGGAGG + Intronic
1120939072 14:89929153-89929175 ATTTGGGAGGCTGAGATGGGAGG - Intronic
1121603904 14:95226682-95226704 ATTTAAGAGGCTGGGATGGGAGG - Intronic
1121824652 14:97000596-97000618 TTTTATGAACCTCAGAGGGGAGG + Intergenic
1122491265 14:102117398-102117420 TTTTATGGGCCTCAGAGGGGAGG - Intronic
1122677940 14:103432745-103432767 ACTTAGGAGGCTAAGATGGGAGG + Intronic
1122752528 14:103948760-103948782 ACTTAGGAGGCTGAGATGGGAGG + Intronic
1124018575 15:25899545-25899567 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
1124615015 15:31235318-31235340 ATTTAGGAGGCTAAGGTGGGAGG - Intergenic
1126459896 15:48903872-48903894 ACTTGGGAGGCTTAGATGGGAGG - Intronic
1126524940 15:49642816-49642838 ATTTGGGAGGCTGAGATGGGAGG + Intronic
1126637958 15:50797514-50797536 CTTTAGGAGGCTGAGATGGGTGG + Intergenic
1126650237 15:50912905-50912927 ATTTAGGAGGCTGAGGTGGGTGG - Intronic
1126767660 15:52025130-52025152 ACTTATGAGGCTGAGATGAGAGG + Intronic
1127344812 15:58083772-58083794 ATTTGGGAGGCTGAGATGGGAGG - Intronic
1127509507 15:59625990-59626012 CTTTAGGAGGCTGAGATGGGGGG - Intronic
1127969913 15:63950322-63950344 ATTCAAGAGGCTGAGATGGGAGG - Intronic
1128163018 15:65436906-65436928 ATTTAGGAGGCTGAGGTGGGAGG - Intergenic
1128481821 15:68046147-68046169 TTTTATGGGCCTCAGATGGGAGG - Intergenic
1129007824 15:72389037-72389059 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1129369029 15:75076490-75076512 TTTTATGGGCCTCAGAGGGGAGG + Intronic
1129377720 15:75144787-75144809 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1129852546 15:78802078-78802100 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
1129997814 15:80022175-80022197 ACTTATGAGGCTAAGGTGGGAGG - Intergenic
1130083626 15:80757776-80757798 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1130183179 15:81651853-81651875 TTTTATGGGCCTAAGAGGGGAGG - Intergenic
1130227805 15:82073140-82073162 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1130409089 15:83629709-83629731 ACTTAGGAGGCTTAGGTGGGAGG + Intergenic
1130446546 15:84007444-84007466 ATTCAGGAGGCTGAGATGGGAGG + Intronic
1130475035 15:84257564-84257586 ACTTATGAGGCTGAGGTGGGAGG + Intergenic
1130482450 15:84371617-84371639 ACTTATGAGGCTGAGGTGGGAGG + Intergenic
1130560850 15:84957508-84957530 ATTTGGGAGGCATAGATGGGTGG - Intergenic
1130838477 15:87674834-87674856 ATTTAAGAGGCTAAGGTGGGAGG - Intergenic
1131005967 15:88978859-88978881 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1131023943 15:89123704-89123726 ACTTGTGAGGCTGAGATGGGAGG - Intronic
1131037235 15:89230922-89230944 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
1131319168 15:91369566-91369588 ATTTAGGAGGCTAATATGGGAGG + Intergenic
1132104802 15:99055613-99055635 CTTTGTGAGGCTTAGGTGGGTGG - Intergenic
1132179830 15:99743851-99743873 ATTTGGGAGGCTGAGATGGGAGG + Intergenic
1132186038 15:99802610-99802632 ACTCATGAGGCTGAGATGGGAGG - Intergenic
1132305355 15:100807942-100807964 ATTTATGGGCCTCAGAGGGGAGG - Intergenic
1132815327 16:1823186-1823208 CTTTAAGAGACTGAGATGGGAGG + Intronic
1133722374 16:8506974-8506996 ACTCAGGAGGCTTAGATGGGAGG + Intergenic
1133935142 16:10263046-10263068 ATTTGGGAGGCTGAGATGGGAGG + Intergenic
1134060503 16:11196968-11196990 ATTTGGGAGGCTGAGATGGGTGG - Intergenic
1134136681 16:11681061-11681083 ACTTAGGAGCCTGAGGTGGGAGG + Intronic
1134224228 16:12379243-12379265 ATTTAGGAGCCTGAAGTGGGAGG - Intronic
1134232898 16:12442835-12442857 ACTTGTGAGGCTGAGATGGGAGG - Intronic
1134384007 16:13755122-13755144 ATTTAGGAGGCCGAGATGGGAGG - Intergenic
1134398948 16:13890921-13890943 ACTCATGAGGCTGAGATGGGAGG + Intergenic
1134474773 16:14563642-14563664 ATTTATGAGGCTGAGGTGGGAGG - Intronic
1134605557 16:15568392-15568414 CTTTAGGAGGCTGAGATGGGTGG + Intronic
1134660762 16:15982695-15982717 ACTCATGAGGCTGAGATGGGAGG + Intronic
1135057063 16:19240522-19240544 TTTTATGGGCCTCAGAGGGGAGG + Intronic
1135531791 16:23260872-23260894 ACTCATGAGGCTGAGATGGGAGG - Intergenic
1135536082 16:23295593-23295615 CTTTATGAGGCTGAGGTGGGAGG - Intronic
1135566332 16:23513961-23513983 ATCTATTAGACTTAGGTGGGGGG - Intronic
1135739539 16:24961775-24961797 CTTTGTGAGGCTGAGATGGGAGG - Intronic
1135774568 16:25245345-25245367 CTTTAGGAGACTGAGATGGGAGG - Intronic
1135790277 16:25387933-25387955 CTTTAGGAGGCTGAGATGGGAGG - Intergenic
1135815966 16:25634091-25634113 CTTTGGGAGCCTGAGATGGGAGG - Intergenic
1136352980 16:29723501-29723523 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1136596468 16:31253577-31253599 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
1136688539 16:32010594-32010616 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1137036336 16:35573082-35573104 CTTTAGGAGGCTGAGATGGGAGG - Intergenic
1137085430 16:36115374-36115396 ATTTATGATCTTTAGATGATGGG + Intergenic
1137256826 16:46782390-46782412 CTTTAGGAGCCTGAGGTGGGTGG - Intronic
1137388411 16:48060948-48060970 ATTTGGGAGCCTGAAATGGGTGG + Intergenic
1137426105 16:48382276-48382298 ACTTATGAGGCTAAGGTGGGGGG + Intronic
1137647948 16:50092371-50092393 ATTTAGGAACCTTAGCTGAGAGG + Intronic
1137964046 16:52913463-52913485 CTTTAGGAGGCTGAGATGGGAGG + Intergenic
1138090304 16:54168365-54168387 CTTTAGGAGGCTTAGGTGGGTGG - Intergenic
1138308552 16:56002538-56002560 ATTTGTGAGGCTGAGGTGGGAGG + Intergenic
1138557528 16:57781204-57781226 ATTCAGGAGGCTTAGGTGGGAGG + Intronic
1138648333 16:58441620-58441642 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1139190776 16:64860479-64860501 TTTTGTGAGGCTAAGATGGGCGG - Intergenic
1139219253 16:65162892-65162914 ATTTGGGAGGCTGAGATGGGCGG + Intergenic
1139538182 16:67592460-67592482 ATTTAGGAGGCTGAGGTGGGAGG + Intronic
1139565034 16:67769333-67769355 ACTTAGGAGGCTGAGATGGGAGG + Intronic
1139638916 16:68276884-68276906 ATTCAGGAGGCTGAGATGGGAGG + Intronic
1139685634 16:68601157-68601179 GTTTAGGAGGCTGAGATGGGAGG + Intergenic
1139730059 16:68936073-68936095 ATTTAGGAGGCTTAGGTGGGAGG + Intronic
1139748969 16:69097041-69097063 ATTTAGGAGGCTAAGGTGGGAGG + Intergenic
1140439745 16:74978381-74978403 ATTCAGGAGGCTGAGATGGGAGG + Intronic
1140677849 16:77351113-77351135 ATTTATGATCCTCAGAGGTGTGG + Intronic
1142314833 16:89337075-89337097 ATTTGGGAGGCTGAGATGGGAGG + Intronic
1142405853 16:89889284-89889306 ATTTGGGAGACTGAGATGGGAGG - Intronic
1142475728 17:188097-188119 ATTGAGGAGGCTGAGATGGGAGG - Intergenic
1142657972 17:1406883-1406905 CTTTAGGAGGCTTAGGTGGGGGG + Intergenic
1143547760 17:7608998-7609020 ATTTAGGAGGCTAAGGTGGGAGG + Intronic
1144337717 17:14286797-14286819 ACTTGGGAGGCTTAGATGGGAGG - Intergenic
1144602028 17:16624926-16624948 ATTTGTGAGGCTGAGGTGGGAGG + Intronic
1144607534 17:16680317-16680339 ACTTAAGAGGCTGAGATGGGAGG + Intergenic
1144834492 17:18149842-18149864 ACTTAGGAGGCTGAGATGGGAGG + Intronic
1145195886 17:20894877-20894899 ATTTGGGAGCCTAAGGTGGGCGG - Intronic
1145197296 17:20905794-20905816 ACTTAAGAGGCTGAGATGGGAGG - Intergenic
1145217059 17:21060700-21060722 TTTTATGGGCCTCAGAAGGGAGG + Intergenic
1145689261 17:26718809-26718831 ATTTATGATCTTTAGATGACGGG - Intergenic
1145723727 17:27097278-27097300 GTTTGGGAGCCTGAGATGGGTGG - Intergenic
1145819372 17:27819730-27819752 ACTTGGGAGGCTTAGATGGGAGG + Intronic
1145883194 17:28366356-28366378 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
1146024567 17:29308539-29308561 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1146188916 17:30747848-30747870 ATTCAGGAGGCTAAGATGGGAGG - Intergenic
1146209605 17:30931710-30931732 ACTTAAGAGGCTGAGATGGGAGG + Intronic
1146333803 17:31952167-31952189 ATTCAGGAGGCTAAGATGGGAGG - Intronic
1146663522 17:34681436-34681458 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
1146981448 17:37165782-37165804 ATTTGGGAGGCTGAGATGGGAGG - Intronic
1147391839 17:40114084-40114106 TTCTATAAGCCTTAGAGGGGTGG + Intergenic
1147625016 17:41894476-41894498 ACTTAGGAGACTGAGATGGGAGG + Intronic
1147654979 17:42084098-42084120 TTTTAGGAGGCTGAGATGGGAGG + Intergenic
1147730693 17:42599409-42599431 CTTTGGGAGCCTTAGGTGGGTGG + Intronic
1147935640 17:44009223-44009245 ATTTAGGAGGCTGACATGGGAGG - Intergenic
1148012189 17:44492054-44492076 ATTTAGGAGGCTGAGGTGGGTGG + Intronic
1148062338 17:44845519-44845541 ATTTAGGAGGCTGAGATGGGAGG + Intergenic
1148078301 17:44952715-44952737 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
1148435547 17:47681649-47681671 ATTTAGGAGGCTGAGGTGGGTGG - Intronic
1148695899 17:49558048-49558070 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1148891074 17:50807571-50807593 ACTTGGGAGCCTGAGATGGGAGG + Intergenic
1149826274 17:59831278-59831300 ATTCAAGAGGCTGAGATGGGAGG - Intronic
1149884680 17:60328201-60328223 TTTTATGGGCCTCAGAGGGGAGG - Intronic
1149959610 17:61093476-61093498 ACTTAGGAGGCTGAGATGGGAGG + Intronic
1150033480 17:61767383-61767405 ACTTAGGAGGCTGAGATGGGAGG - Intronic
1150070808 17:62148346-62148368 ATTTAGGAGACTGAGGTGGGTGG - Intergenic
1150077155 17:62202298-62202320 CTTTCTGAGCCTGAGGTGGGAGG + Intergenic
1150098369 17:62399274-62399296 ATTTGGGAGGCTGAGATGGGAGG - Intronic
1150244016 17:63660310-63660332 ACTTGTGAGGCTGAGATGGGAGG - Intronic
1150430572 17:65112586-65112608 ACTTAGGAGGCTTAGGTGGGAGG - Intergenic
1150521057 17:65866609-65866631 TTTTATGGGCCTCAGAGGGGAGG - Intronic
1150529158 17:65958901-65958923 TTTTATGTGCCTCAGAGGGGAGG - Intronic
1150766633 17:68007523-68007545 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1150948145 17:69770077-69770099 ATTTATGAAGCTTAGTTTGGTGG + Intergenic
1150950981 17:69801891-69801913 TTTTATGAGCCTCAGAAGGGAGG - Intergenic
1150952820 17:69821879-69821901 TTTTATGGGCCTTAGATGTGAGG - Intergenic
1151010048 17:70483851-70483873 TTTTATGGGCCTCAGAGGGGTGG + Intergenic
1151077875 17:71295351-71295373 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1151480315 17:74366685-74366707 ATTTGGGAGGCTGAGATGGGAGG + Intergenic
1151605576 17:75133295-75133317 ACTCATGAGCCTTAGGTGGGAGG + Intergenic
1151773101 17:76177689-76177711 TTTTATGGGCCTCAGAGGGGAGG - Intronic
1152484424 17:80580869-80580891 CTTTAGGAGGCTGAGATGGGAGG - Intronic
1203182446 17_KI270729v1_random:74456-74478 ATTTATGATCTTTAGATGATGGG - Intergenic
1153053774 18:925699-925721 ACTTAAGAGGCTGAGATGGGAGG + Intergenic
1153197461 18:2616266-2616288 CTTTATGAGGCTGAGGTGGGTGG - Intronic
1153428781 18:4992914-4992936 TTTTATGAGCTTCAGAGGGGAGG + Intergenic
1153936932 18:9935463-9935485 ATTTAGGAGCCTGAAGTGGGAGG + Intronic
1154012900 18:10590715-10590737 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1154151938 18:11913175-11913197 ACTTAGGAGGCTAAGATGGGAGG - Intergenic
1154994665 18:21628269-21628291 ACTCAGGAGGCTTAGATGGGAGG + Intronic
1155135676 18:22989779-22989801 ATTTGGGAGGCTGAGATGGGAGG - Intronic
1155147423 18:23095561-23095583 ATTTTGGAGGCTGAGATGGGAGG + Intergenic
1155199112 18:23502330-23502352 ACTTGTGAGGCTGAGATGGGAGG + Intergenic
1155494239 18:26427031-26427053 CTTTGTGAGGCTGAGATGGGAGG + Intergenic
1155494288 18:26427408-26427430 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
1156017943 18:32567341-32567363 ATTTGTGAGGCTGAGATGAGTGG + Intergenic
1156236801 18:35213516-35213538 ACTTAGGAGGCTAAGATGGGAGG - Intergenic
1156327289 18:36085706-36085728 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
1156339465 18:36198278-36198300 AGTTAGGAGGCTGAGATGGGAGG + Intronic
1157107554 18:44788904-44788926 ACTCATGAGGCTGAGATGGGAGG - Intronic
1157292258 18:46418246-46418268 ACTTAGGAGGCTGAGATGGGAGG + Intronic
1157770750 18:50343766-50343788 CTTTGTGAGCCTGAGTTGGGTGG - Intergenic
1157836157 18:50905226-50905248 CTTTGGGAGCCTTAGGTGGGTGG - Intronic
1157949617 18:52020088-52020110 CTTTAGGAGGCTGAGATGGGAGG + Intergenic
1158632995 18:59132302-59132324 TTTTATGAACCTCAGAGGGGAGG - Intergenic
1158808230 18:61000573-61000595 CTTTGTGAGGCCTAGATGGGTGG - Intergenic
1159638529 18:70835993-70836015 CTTTAGGAGGCTGAGATGGGTGG + Intergenic
1160573335 18:79833242-79833264 ATTTTGGAGGCTGAGATGGGGGG - Intergenic
1161312189 19:3600935-3600957 ATTTGGGAGGCTGAGATGGGGGG - Intronic
1161634036 19:5375944-5375966 ACTTATGAGGCTGAGGTGGGAGG - Intergenic
1161852054 19:6742671-6742693 ATTTGGGAGCCTGAGGTGGGAGG + Intronic
1161871727 19:6875649-6875671 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
1161938344 19:7386126-7386148 ATTTGTGAGGCTGAGGTGGGAGG - Intronic
1161955784 19:7494148-7494170 CTTTAGGAGGCTGAGATGGGAGG - Intronic
1162201217 19:9021852-9021874 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1162403597 19:10460905-10460927 ACTTAGGAGGCTGAGATGGGAGG - Intronic
1162493802 19:11011606-11011628 ACTTAAGAGGCTGAGATGGGAGG + Intronic
1162754515 19:12849281-12849303 ACTTAGGAGGCTGAGATGGGAGG + Intronic
1162803639 19:13124833-13124855 ATTTAGGAGGCTGAGATGGGAGG + Intronic
1162809856 19:13157254-13157276 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
1162819486 19:13213927-13213949 ATTTAGGAGGCCAAGATGGGAGG - Intronic
1162840555 19:13353373-13353395 ATTTGGGAGTCTGAGATGGGTGG - Intronic
1162880243 19:13653487-13653509 ATTTGGGAGCCTGAGGTGGGAGG + Intergenic
1162915752 19:13873583-13873605 ACTTAGGAGGCTGAGATGGGAGG - Intronic
1162996781 19:14340880-14340902 ATTTGGGAGGCTGAGATGGGAGG + Intergenic
1163269548 19:16243375-16243397 ACTTGTGAGACTGAGATGGGAGG - Intronic
1163350306 19:16772724-16772746 ATTTGGGAGGCTGAGATGGGAGG + Intronic
1163620145 19:18354624-18354646 ATTCAGGAGGCTGAGATGGGAGG - Intronic
1163650123 19:18512528-18512550 ATTTAGGAGGCTGAGGTGGGAGG + Intronic
1163690200 19:18734573-18734595 ACTTAGGAGGCTGAGATGGGAGG + Intronic
1163793053 19:19319491-19319513 CTTTAAGAGGCTGAGATGGGAGG + Intronic
1163893257 19:20035465-20035487 ATTTAGGAGGCTGAGGTGGGTGG - Intronic
1163931442 19:20397023-20397045 ATTTGGGAGGCTGAGATGGGTGG + Intergenic
1164536812 19:29092252-29092274 ACTTAGGAGCCTGAGGTGGGAGG - Intergenic
1164732259 19:30515151-30515173 ACTTGGGAGCCTGAGATGGGAGG + Intronic
1165022646 19:32936592-32936614 TTTTATGGGCCTCAGAAGGGAGG - Intronic
1165087776 19:33363207-33363229 ATTTGTGGGGCTTAGGTGGGAGG + Intergenic
1165664356 19:37614377-37614399 CTTTAGGAGGCTGAGATGGGTGG + Intronic
1165695937 19:37901028-37901050 ATTTGGGAGGCTGAGATGGGAGG + Intronic
1165765526 19:38348402-38348424 CTTTAGGAGGCCTAGATGGGAGG - Intronic
1166107530 19:40604732-40604754 ACTTAGGAGGCTCAGATGGGAGG + Intronic
1166131366 19:40747755-40747777 ATTTTGGAGGCTGAGATGGGAGG + Intronic
1166535862 19:43574472-43574494 CTTTCAGAGCCTGAGATGGGAGG - Intronic
1166687789 19:44806390-44806412 ATTTAGGAGCCTGAGGCGGGAGG - Intergenic
1166766641 19:45255091-45255113 ACTCAGGAGCCTGAGATGGGAGG + Intronic
1166849502 19:45752448-45752470 CTTTAGGAGGCTGAGATGGGTGG - Intronic
1167059143 19:47132518-47132540 TTTTAGGAGTCTGAGATGGGGGG - Intronic
1167164991 19:47793046-47793068 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1167341630 19:48919875-48919897 ACTCATGAGGCTGAGATGGGAGG - Intronic
1167695338 19:51012251-51012273 CTTTAGGAGGCTGAGATGGGTGG - Intergenic
1167789685 19:51666495-51666517 ATTTGGGAGCCTAAGGTGGGAGG + Intergenic
1167800537 19:51738384-51738406 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1168090250 19:54078128-54078150 ATTTTGGAGGCTAAGATGGGCGG - Intronic
1202668637 1_KI270709v1_random:26383-26405 ATTTATGATCTTTAGATGACGGG - Intergenic
925048198 2:790266-790288 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
926021909 2:9503907-9503929 CTTTAGGAGGCTTAGAAGGGTGG + Intronic
926022597 2:9510273-9510295 CTTTAGGAGGCTGAGATGGGAGG + Intronic
926177904 2:10612918-10612940 ATTCCTGAGGCTGAGATGGGAGG + Intronic
926625457 2:15086153-15086175 TTTTATGAGTCTTGGAGGGGAGG - Intergenic
927166025 2:20322499-20322521 ATTTAGGAGGCTGAGATGGGAGG + Intronic
927627245 2:24734696-24734718 ACTTAGGAGCCTAAGTTGGGAGG + Intronic
927648243 2:24893714-24893736 GTTTGTGAGGCTGAGATGGGAGG - Intronic
927784689 2:25965570-25965592 ATTTGGGAGGCTTAGGTGGGAGG - Intronic
929010334 2:37435970-37435992 ATTTGGGAGGCTGAGATGGGAGG + Intergenic
929210869 2:39355420-39355442 ATTCATGAGGCTGAGGTGGGAGG + Intronic
929288171 2:40159708-40159730 ATTTATGAACATTAAATGGTGGG - Intronic
929703666 2:44188502-44188524 ATTCAGGAGGCTGAGATGGGTGG - Intronic
929714647 2:44297839-44297861 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
930709758 2:54539646-54539668 ACTTATGAGGCTGAGGTGGGAGG - Intronic
930729032 2:54709778-54709800 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
930800641 2:55439242-55439264 ATTCAGGAGGCTTAGGTGGGAGG - Intergenic
930818820 2:55625333-55625355 CTTTAAGAGGCTGAGATGGGAGG - Intergenic
931049574 2:58395875-58395897 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
931375368 2:61702909-61702931 CTTTAGGAGGCTAAGATGGGAGG + Intergenic
931693641 2:64856061-64856083 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
932501627 2:72187685-72187707 TTTTATGGGCCTCAGAGGGGAGG + Intronic
932551692 2:72776506-72776528 ACTCATGAGGCTGAGATGGGAGG + Intronic
932562197 2:72882961-72882983 ACTTAGGAGGCTGAGATGGGAGG + Intergenic
932868016 2:75367287-75367309 ATTTATGAAGCTTAGTTTGGTGG + Intergenic
933679642 2:85088428-85088450 CTTTAGGAGGCTGAGATGGGAGG + Intergenic
933692843 2:85192930-85192952 CTTTATGAGGCTGAGGTGGGAGG - Intronic
934582366 2:95454135-95454157 CTTTAGGAGCCTAAGATGGGAGG + Intergenic
934597084 2:95622579-95622601 CTTTAGGAGCCTAAGATGGGAGG - Intergenic
934673365 2:96231265-96231287 ATTTAGGAGGCTGAGGTGGGAGG - Intergenic
934696509 2:96404420-96404442 TTTTGTGAGCCTCAGAGGGGGGG + Intergenic
934764271 2:96871560-96871582 ATTTGGGAGGCTGAGATGGGAGG + Intergenic
934842794 2:97640421-97640443 CTTTAGGAGCCTAAGATGGGAGG + Intergenic
934932458 2:98438129-98438151 ATTTAGGAGGCTGAGATGGGAGG - Intergenic
935168192 2:100588103-100588125 ATTTGGGAGGCTGAGATGGGTGG - Intergenic
935613420 2:105050381-105050403 ATTTGGGAGGCTGAGATGGGTGG - Intronic
935806791 2:106756847-106756869 ATTAATGATCTTGAGATGGGGGG - Intergenic
936028218 2:109050360-109050382 ATTTAGGAGGCTGAGGTGGGAGG - Intergenic
936350347 2:111707597-111707619 CTTTATGAGGCTGAGGTGGGTGG - Intergenic
936398027 2:112143824-112143846 CTTTACGAGGCTGAGATGGGAGG - Intronic
936739924 2:115492527-115492549 ATTTATGAGCCTTAGATGGGCGG + Intronic
937270376 2:120647143-120647165 ACTTAGGAGGCTGAGATGGGAGG + Intergenic
937361091 2:121230662-121230684 ACTTAGGAGCCTGAGGTGGGAGG + Intronic
937599291 2:123710709-123710731 ACTCAGGAGGCTTAGATGGGAGG - Intergenic
937754701 2:125522617-125522639 ATTTGGGAGGCTTAGATGGCAGG + Intergenic
937893046 2:126954630-126954652 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
938180643 2:129179139-129179161 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
938367030 2:130743029-130743051 ACTCAGGAGCCTGAGATGGGAGG - Intergenic
938550577 2:132377916-132377938 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
939709672 2:145501765-145501787 ACTTAGGAGCCTGAGGTGGGAGG + Intergenic
939968586 2:148635473-148635495 ATTTAGGAGGCTAAGGTGGGAGG + Intergenic
940250259 2:151667634-151667656 ATTTGAGAGGCTGAGATGGGAGG - Intronic
940306156 2:152229291-152229313 ATTTGGGAGGCTAAGATGGGAGG - Intergenic
940866748 2:158825061-158825083 ATTTGGGAGGCTTAGACGGGAGG - Intronic
941084139 2:161097022-161097044 ATTCAGGAGCCTGAGGTGGGAGG + Intergenic
941170399 2:162128947-162128969 CTTTAGGAGGCTGAGATGGGAGG + Intergenic
941312554 2:163952407-163952429 CTTTATGAGGCTGAGGTGGGTGG + Intergenic
941420563 2:165278819-165278841 ACTTAGGAGGCTGAGATGGGAGG + Intronic
941497261 2:166221507-166221529 ACTTAGGAGCCTGAGGTGGGAGG - Intronic
942053464 2:172162305-172162327 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
942253944 2:174073096-174073118 ACTTAGGAGGCTGAGATGGGAGG - Exonic
942288670 2:174448130-174448152 ATTTGGGAGGCTGAGATGGGCGG + Intronic
942600062 2:177631939-177631961 ATTTATGATCCTAACATGTGGGG - Intronic
943064124 2:183069315-183069337 TTTTATGAGCTTCAGAAGGGAGG - Intergenic
943179424 2:184524549-184524571 TTTTATGGGCTTTAGAAGGGAGG + Intergenic
943183678 2:184576750-184576772 ACTCAGGAGGCTTAGATGGGAGG + Intergenic
943226527 2:185185523-185185545 TTTTATGAGCTTTAGAAGGGAGG - Intergenic
943345664 2:186734593-186734615 TTTTATGGGCTTCAGATGGGCGG + Intronic
943590779 2:189793997-189794019 ATTTACGAGGCTGAGATGGGTGG - Intronic
943960228 2:194254551-194254573 TTTTATGGGCTTTAGATGGGTGG - Intergenic
944392452 2:199230867-199230889 ATTTAGGAGGCCAAGATGGGTGG + Intergenic
944583091 2:201149996-201150018 CTTTGTGAGGCTGAGATGGGAGG + Intronic
944652751 2:201848015-201848037 ATTCAGGAGGCTGAGATGGGAGG + Intronic
944732213 2:202528076-202528098 ATTTAGGAGGCTGAGGTGGGAGG + Intronic
944809983 2:203318450-203318472 ACTTAGGAGGCTTAGATTGGAGG + Intergenic
945215315 2:207427550-207427572 ATTTGGGAGGCTGAGATGGGAGG + Intergenic
945216583 2:207440873-207440895 CTTTAGGAGGCTGAGATGGGCGG - Intergenic
945290889 2:208126149-208126171 ACTTAGGAGGCTGAGATGGGAGG + Intergenic
945421962 2:209649140-209649162 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
945625679 2:212202582-212202604 ATTTGGGAGGCTTAGGTGGGAGG - Intronic
945734426 2:213581457-213581479 TTTTAGGAGGCTGAGATGGGAGG - Intronic
945770384 2:214035191-214035213 TTTTATGGGCCTCAGAGGGGAGG + Intronic
945915909 2:215703621-215703643 ATTCAAGAGTCTGAGATGGGAGG + Intergenic
946273944 2:218616606-218616628 ATTTGGGAGGCTAAGATGGGAGG + Intronic
946622959 2:221578303-221578325 ACTCAGGAGCCTGAGATGGGAGG - Intergenic
946848144 2:223879410-223879432 CTTTGGGAGCCTGAGATGGGAGG + Intronic
946995696 2:225388754-225388776 ATTTAGGAGGCTGAGATAGGAGG + Intergenic
947161737 2:227222043-227222065 ACTTAAGAGGCTGAGATGGGAGG + Intronic
947174815 2:227354915-227354937 ATTTAGGAGGCTGAGGTGGGTGG + Intronic
947263986 2:228255731-228255753 ATTTAGGAGGCTGAGGTGGGTGG - Intergenic
947327252 2:228992373-228992395 TTTTATGGGCCTCAGATTGGAGG + Intronic
947433431 2:230051268-230051290 ACTTAGGAGGCTGAGATGGGAGG - Intronic
947487708 2:230567573-230567595 ATTTAGGAGGCTGAGATGGGAGG + Intergenic
947785274 2:232812890-232812912 ATTCAGGAGGCTGAGATGGGAGG + Intronic
948713007 2:239836827-239836849 TTTTAAGAGCCTCAGAGGGGAGG - Intergenic
1168784460 20:525894-525916 ATTCAGGAGTCTGAGATGGGAGG + Intronic
1168985595 20:2045864-2045886 TTTTAGGAGGCTGAGATGGGTGG + Intergenic
1169102269 20:2960643-2960665 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
1169152512 20:3301121-3301143 ATTTGGGAGGCTTAGGTGGGAGG - Intronic
1169164484 20:3410229-3410251 ATTCAGGAGACTGAGATGGGAGG + Intergenic
1169199365 20:3700473-3700495 ATTTGGGAGGCTGAGATGGGAGG + Intronic
1169269159 20:4186196-4186218 ACTTAGGAGGCTTAGATGGGAGG + Intronic
1169300891 20:4441099-4441121 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1169360375 20:4943564-4943586 ATTTAGGAGACTGAGGTGGGAGG + Intronic
1169362171 20:4959890-4959912 ACTTATGAGGCTGAGGTGGGAGG - Intronic
1169497087 20:6125356-6125378 ATTTAGGAGGCTAAGATGGGAGG - Intergenic
1169539844 20:6587606-6587628 ACTTGGGAGGCTTAGATGGGAGG - Intergenic
1169876663 20:10305431-10305453 ATTTAGGAGGCTGAGATGGGAGG + Intronic
1170004191 20:11647228-11647250 TTTTATGGGCCTCAGAAGGGAGG - Intergenic
1170222706 20:13957767-13957789 ACTTAGGAGGCTTAGGTGGGAGG + Intronic
1170337952 20:15292117-15292139 ATTCAGGAGGCTGAGATGGGAGG - Intronic
1170500193 20:16967911-16967933 ATTCCTGAGCCAAAGATGGGGGG - Intergenic
1170828139 20:19814699-19814721 ACTTGTGAGCCTAAGGTGGGAGG - Intergenic
1170982787 20:21230364-21230386 ATTTAAGAGGCTAAGGTGGGAGG + Intronic
1171792583 20:29541627-29541649 ATTTGGGAGCCTGAGGTGGGAGG + Intergenic
1172139200 20:32709985-32710007 ACTTAGGAGCCTGAGGTGGGAGG - Intronic
1172243360 20:33428298-33428320 ATTCAGGAGGCTGAGATGGGAGG + Intronic
1172299239 20:33837240-33837262 ATTTCGGAGGCTGAGATGGGAGG + Intronic
1172326784 20:34041994-34042016 ATTCAGGAGGCTGAGATGGGAGG + Intronic
1172371708 20:34398304-34398326 ATTTAGGAGGCTGAGGTGGGTGG - Intronic
1172412353 20:34734587-34734609 CTTTAGGAGGCTGAGATGGGAGG - Intronic
1172545860 20:35760844-35760866 ACTTGGGAGGCTTAGATGGGAGG + Intergenic
1172743460 20:37187747-37187769 ACTTAGGAGGCTGAGATGGGAGG - Intronic
1173299473 20:41788881-41788903 ACTTAGGAGGCTGAGATGGGAGG + Intergenic
1173510358 20:43623291-43623313 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
1173552214 20:43940465-43940487 ATTTGTGAGGCCGAGATGGGAGG - Intronic
1173597581 20:44269295-44269317 AACTATGAGTCTTAGATGGCAGG + Intronic
1173606440 20:44335387-44335409 ATTCAGGAGGCTGAGATGGGAGG + Intergenic
1174233240 20:49064909-49064931 CTTTAGGAGGCTCAGATGGGAGG + Intronic
1174242272 20:49146591-49146613 ACTTAGGAGGCTGAGATGGGAGG + Intronic
1174319886 20:49733190-49733212 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1174626778 20:51921816-51921838 CTTTAGGAGGCTGAGATGGGCGG - Intergenic
1175113085 20:56662766-56662788 CTTTAGGAGGCTGAGATGGGTGG + Intergenic
1176136713 20:63525969-63525991 CTTTGGGAGCCTGAGATGGGAGG + Intergenic
1176976511 21:15327244-15327266 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
1177211830 21:18081435-18081457 ATTTGGGAGGCTGAGATGGGTGG + Intronic
1177333724 21:19696834-19696856 ATTCTTGAGCCTTAGATAGTGGG + Intergenic
1177454430 21:21317639-21317661 ATTTAAGAGGCTGAGATGGGAGG - Intronic
1177681137 21:24373058-24373080 ACTTGGGAGCCTGAGATGGGAGG - Intergenic
1177926251 21:27219438-27219460 ATTTCAGAGACTTAGGTGGGTGG - Intergenic
1178009358 21:28264997-28265019 CTTTGGGAGGCTTAGATGGGAGG + Intergenic
1178338220 21:31763058-31763080 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1178373293 21:32045662-32045684 ACTTCTGACCCATAGATGGGTGG - Intergenic
1178862934 21:36304438-36304460 CTTTGGGAGGCTTAGATGGGAGG - Intergenic
1179000006 21:37448803-37448825 ACTTAGGAGGCTGAGATGGGAGG - Intronic
1179037551 21:37772036-37772058 ATTTATGGGCCATAGATGTGTGG - Intronic
1179197675 21:39181242-39181264 ACTCAGGAGCCTGAGATGGGAGG - Intronic
1179989138 21:44937403-44937425 ATTCAGGAGGCTAAGATGGGAGG + Intronic
1180318240 22:11296686-11296708 ATTCAGGAGCCTGAGGTGGGAGG - Intergenic
1180327294 22:11441325-11441347 ATTTGGGAGGCTTAGGTGGGAGG + Intergenic
1181712322 22:24698181-24698203 ACTTAGGAGGCTGAGATGGGAGG + Intergenic
1181949849 22:26545966-26545988 ACTTGGGAGGCTTAGATGGGAGG + Intronic
1181973354 22:26710583-26710605 CTTTAGGAGGCTGAGATGGGAGG + Intergenic
1182126283 22:27818174-27818196 ACTCAGGAGGCTTAGATGGGAGG + Intergenic
1182214170 22:28702058-28702080 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
1182318191 22:29461742-29461764 TTTTAGGAGCCTGAGGTGGGAGG - Intergenic
1182372891 22:29824504-29824526 ATTTGGGAGGCTGAGATGGGAGG + Intronic
1182384529 22:29925670-29925692 ATTTGGGAGGCTGAGATGGGTGG + Intronic
1182399968 22:30067606-30067628 ATTCAGGAGGCTTAGTTGGGAGG + Intergenic
1182536762 22:31009581-31009603 ATTTGGGAGACTGAGATGGGTGG + Intergenic
1182607473 22:31517354-31517376 ATTTGGGAGGCTGAGATGGGAGG - Intronic
1182771020 22:32796555-32796577 AATTCTGAGCCTAAGATGCGAGG - Intronic
1182814882 22:33153269-33153291 ATTCAGGAGCCTGAGGTGGGAGG - Intergenic
1183092874 22:35535293-35535315 ATTTAGGAGCCTGAGGTGGGAGG + Intergenic
1183146568 22:35997891-35997913 ACTTAGGAGGCTTAGGTGGGAGG + Intronic
1183405382 22:37627933-37627955 ACTCAGGAGCCTGAGATGGGAGG - Intronic
1183429338 22:37756215-37756237 ATTTGGGAGGCTGAGATGGGAGG + Intronic
1184613673 22:45622985-45623007 ACTTGGGAGGCTTAGATGGGAGG - Intergenic
1184869413 22:47225868-47225890 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1184887338 22:47354454-47354476 ACTTCTGGGCCTTAGCTGGGGGG - Intergenic
1185357048 22:50379769-50379791 ACTTAGGAGGCTGAGATGGGAGG + Intronic
949469035 3:4375025-4375047 ACTTAGGAGGCTGAGATGGGAGG + Intronic
949470731 3:4393439-4393461 ATTCAGGAGGCTGAGATGGGAGG - Intronic
949961865 3:9318768-9318790 ACTTAGGAGGCTGAGATGGGGGG + Intronic
949971975 3:9415696-9415718 ATTTAAGAGGCTGAGGTGGGAGG - Intronic
950070452 3:10147985-10148007 ATTTGGGAGGCTTAGGTGGGAGG + Intronic
950276936 3:11669786-11669808 ATTCAGGAGGCTGAGATGGGAGG - Intronic
951126112 3:18985478-18985500 ATTTGTGATCCTTGGATGTGGGG - Intergenic
951401381 3:22236438-22236460 ACTTGGGAGGCTTAGATGGGAGG - Intronic
951718455 3:25673781-25673803 TTTTATGGGCATTAGAGGGGAGG + Intergenic
951891133 3:27569185-27569207 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
952106880 3:30080633-30080655 ACTTTTGAGACTGAGATGGGAGG + Intergenic
952118344 3:30211676-30211698 ATTTAGGAGGCTGAGATGGGAGG + Intergenic
952206588 3:31186445-31186467 ACTTATGAGGCTGAGATGGAAGG + Intergenic
952223446 3:31349144-31349166 CTTTAGGAGGCTAAGATGGGAGG + Intergenic
952337603 3:32417928-32417950 ATTCAGGAGGCTGAGATGGGAGG - Intronic
952354615 3:32572377-32572399 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
952361750 3:32637209-32637231 ACTTAGGAGGCTGAGATGGGAGG + Intergenic
953367805 3:42361619-42361641 ATTTGTCAGCCTGAGTTGGGAGG + Intergenic
953462409 3:43092404-43092426 ATTTGGGAGGCTGAGATGGGAGG - Intronic
953818909 3:46187490-46187512 ATTCAGGAGGCTGAGATGGGAGG - Intronic
953914772 3:46911180-46911202 ATTTACGAGGCTGAGGTGGGCGG - Intergenic
953973322 3:47363747-47363769 ATTCAGGAGGCTGAGATGGGAGG + Intergenic
954013674 3:47665926-47665948 ATCTATGAGGCTGAGATGGAAGG - Intronic
954212657 3:49106922-49106944 ATTTCAGAGGCTGAGATGGGAGG - Intergenic
954550014 3:51473622-51473644 ATTCAGGAGCCTGAGGTGGGAGG - Intronic
954553691 3:51502446-51502468 ATTTATGAGGCTGAGGTGGGAGG + Intergenic
954602702 3:51882497-51882519 ATTCAGGAGGCTGAGATGGGCGG - Intergenic
954642028 3:52106412-52106434 ACTCATGAGGCTGAGATGGGAGG + Intronic
954945187 3:54417893-54417915 ATTTAGGAGGCTGAGATGGGAGG - Intronic
955328637 3:58028857-58028879 CTTTGTGAGACTGAGATGGGTGG - Intronic
956096579 3:65722522-65722544 ACTTAGGAGGCTGAGATGGGAGG + Intronic
956133022 3:66071915-66071937 ATTCATGAGGCTGAGGTGGGAGG + Intergenic
956137337 3:66111982-66112004 ATTTGAGAGGCTGAGATGGGAGG + Intergenic
956185230 3:66556117-66556139 CTTTAAGAGGCTGAGATGGGTGG + Intergenic
956632929 3:71333714-71333736 ATTTAGGAGGCTGAGGTGGGAGG + Intronic
956989969 3:74751716-74751738 CTTTATGGGCCTCAGAGGGGAGG + Intergenic
957053048 3:75425038-75425060 ATTCAGGAGGCTGAGATGGGAGG + Intergenic
957187998 3:76967628-76967650 ATTTGGGAGGCTGAGATGGGAGG - Intronic
957289548 3:78260820-78260842 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
957427035 3:80051842-80051864 GTTTATGGGCCTCAGAGGGGAGG - Intergenic
957624430 3:82640864-82640886 TTTTATGAGCCTCAGAGGAGAGG - Intergenic
957625848 3:82650973-82650995 TTTTATGGGCCTTGGAGGGGAGG - Intergenic
958085672 3:88803161-88803183 ATTTGGGAGCCTGAGGTGGGTGG - Intergenic
958528590 3:95293832-95293854 ATTCTTGAGCATTAGATAGGTGG - Intergenic
958636251 3:96750588-96750610 CTTTATGGGCCTCAGATGGGAGG - Intergenic
958912745 3:100012880-100012902 ACTTAGGAGGCTGAGATGGGAGG - Intronic
959062304 3:101626742-101626764 ATTTGGGAGGCCTAGATGGGAGG - Intergenic
959088841 3:101880882-101880904 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
959289438 3:104454907-104454929 CTTTAGGAGGCTGAGATGGGAGG + Intergenic
959375006 3:105578844-105578866 ATTCATGATGCTTTGATGGGAGG + Intergenic
960192993 3:114729910-114729932 ACTCATGAGGCTAAGATGGGAGG - Intronic
960716428 3:120579667-120579689 ATTTATGAACCTTTGAGTGGTGG - Intergenic
960837061 3:121917577-121917599 ATTTGGGAGGCTGAGATGGGAGG + Intronic
960901517 3:122558817-122558839 ATTCAGGAGACTGAGATGGGAGG - Intronic
961062799 3:123845760-123845782 ATTTGGGAGGCTGAGATGGGTGG - Intronic
961142629 3:124567864-124567886 ATTCAGGAGGCTGAGATGGGAGG + Intronic
961266755 3:125649180-125649202 CTTTAAGAGGCTAAGATGGGAGG + Intergenic
961842675 3:129729864-129729886 CTTTAGGAGGCTGAGATGGGAGG + Intronic
961850849 3:129816778-129816800 CTTTAGGAGGCTGAGATGGGAGG + Intronic
962539413 3:136363860-136363882 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
962571930 3:136722112-136722134 ACTTAGGAGGCTGAGATGGGAGG + Intronic
962576431 3:136759247-136759269 ACTTGTGAGACTGAGATGGGAGG + Intergenic
962824527 3:139088459-139088481 TTTTATGGGCCTCAGAGGGGAGG + Intronic
963157027 3:142110125-142110147 CTTTGGGAGACTTAGATGGGTGG - Intronic
963221682 3:142819886-142819908 CTTTAGGAGGCTGAGATGGGAGG - Intronic
963801528 3:149680588-149680610 ATTTGGGAGGCTGAGATGGGAGG + Intronic
964929315 3:161997161-161997183 ACTAGTGAGGCTTAGATGGGGGG - Intergenic
965072885 3:163938189-163938211 CTTTAGGAGGCTGAGATGGGCGG + Intergenic
965087226 3:164114100-164114122 TTTTGTGAGCCTCAGAGGGGAGG - Intergenic
966069133 3:175853663-175853685 GTTTGGGAGGCTTAGATGGGAGG - Intergenic
966588062 3:181649797-181649819 ATTTGGGAGGCTTAGGTGGGCGG - Intergenic
966951720 3:184825656-184825678 CTTTATGAGGCCGAGATGGGTGG + Intronic
967114395 3:186323548-186323570 CTTTAGGAGGCTAAGATGGGCGG + Intronic
967568757 3:191002760-191002782 ATTTGAGAGGCTGAGATGGGAGG - Intergenic
967824008 3:193864105-193864127 ATGCAGGAGCCTTAGATGGGTGG - Intergenic
968340728 3:197953265-197953287 ATTTGAGAGCCCTAGGTGGGAGG + Intronic
968538661 4:1151076-1151098 TTTTATGGGCCTTAGAGGGGAGG + Intergenic
970905194 4:21207949-21207971 ATTTGGGAGGCTGAGATGGGAGG - Intronic
971075809 4:23147908-23147930 ATTTATGAGCCATAGATTTCTGG - Intergenic
971444294 4:26725654-26725676 ATTTAGGAGGCTGAGGTGGGCGG - Intronic
971456764 4:26852446-26852468 ACTTAGGAGGCTAAGATGGGAGG + Intergenic
971643923 4:29171728-29171750 ATTTAGGAGCCCTAATTGGGTGG - Intergenic
972297048 4:37749445-37749467 ATTTAAGAGGCTGAGATGGGAGG + Intergenic
972358275 4:38303218-38303240 TTTTATGGGCCTTAGAGGGGAGG + Intergenic
972391505 4:38618019-38618041 CTTTAGGAGGCTGAGATGGGGGG - Intergenic
972394412 4:38646416-38646438 CTTTGGGAGGCTTAGATGGGCGG - Intergenic
972480785 4:39493981-39494003 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
973601541 4:52547524-52547546 CTTTAGGAGCCTGAGGTGGGCGG + Intergenic
973694851 4:53480657-53480679 ATTTATGAGGCTTGGCTGGCTGG + Intronic
974014075 4:56633447-56633469 ATTTAGGAGGCTGAGGTGGGAGG - Intergenic
974030834 4:56774964-56774986 ATTTGGGAGGCTTAGGTGGGTGG + Intergenic
974059061 4:57013644-57013666 ACTTAGGAGCCTGAGGTGGGAGG - Intronic
974308615 4:60174676-60174698 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
974461818 4:62198323-62198345 ATTTGTGAGGCTGAGGTGGGAGG + Intergenic
974735873 4:65931470-65931492 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
974790621 4:66683384-66683406 AGTTGTGAGCCTGAGGTGGGAGG - Intergenic
975142401 4:70931837-70931859 ACTTAGGAGACTGAGATGGGAGG - Intronic
975254339 4:72216165-72216187 TTTTATGGGCCTCAGAAGGGAGG + Intergenic
975597770 4:76066621-76066643 ATTTATGGACCTCAGAGGGGAGG + Intronic
976204500 4:82611590-82611612 CTTTGTGAGGCTGAGATGGGAGG + Intergenic
976279238 4:83310561-83310583 ATTTGTGGGACTGAGATGGGAGG + Intronic
976306491 4:83565342-83565364 ATTTGGGAGGCTGAGATGGGAGG - Intronic
976467234 4:85384542-85384564 ATTTGTGAGGCTGAGGTGGGAGG - Intergenic
976730516 4:88256435-88256457 ATTAAGGAGGCTGAGATGGGAGG - Intergenic
976742674 4:88373083-88373105 ATTTGGGAGCCTGAGGTGGGTGG - Intergenic
977419370 4:96778505-96778527 ACTCATGAGGCTAAGATGGGAGG + Intergenic
977471865 4:97452518-97452540 TTTTATGGGCCTCAGAGGGGAGG - Intronic
977991165 4:103444219-103444241 ACATAGGAGGCTTAGATGGGAGG - Intergenic
978578917 4:110213391-110213413 ATTTAGGAGGCTTAGATGGGTGG - Intergenic
978587241 4:110287076-110287098 ATTTGTGAGGCTGAGATGGGAGG + Intergenic
978911803 4:114072275-114072297 ATTTATGAAGCTTAGTTTGGAGG - Intergenic
979010804 4:115365976-115365998 TTTTATGAGCTTCAGAGGGGAGG - Intergenic
979172618 4:117621472-117621494 CTTTAAGAGGCTGAGATGGGAGG - Intergenic
979211268 4:118106680-118106702 ACTCAGGAGACTTAGATGGGAGG + Intronic
979221727 4:118234302-118234324 ATTTGGGAGGCTGAGATGGGAGG + Intronic
979466468 4:121044855-121044877 ATTCATGAGGCTGAGGTGGGAGG + Intronic
979599908 4:122575925-122575947 ATTTAGGAGGCTGAGGTGGGCGG - Intergenic
979649489 4:123114172-123114194 TTTTATGAGCCTCAGAGGGGAGG + Intronic
979665572 4:123307248-123307270 ACTTAGGAGGCTGAGATGGGAGG - Intronic
979692499 4:123574790-123574812 ATTTATGAGACCAAGGTGGGAGG - Intergenic
980039964 4:127927967-127927989 ATTTAGGAGGCTAAAATGGGAGG - Intronic
980253607 4:130349280-130349302 TTTTATCAGCTTCAGATGGGAGG + Intergenic
980474895 4:133300727-133300749 ATTTGTGAGGCTGAGGTGGGTGG + Intergenic
980946491 4:139325755-139325777 ACTCATGAACCTGAGATGGGAGG - Intronic
981258588 4:142692455-142692477 CTTTATGAGGCCTAGACGGGAGG + Intronic
981320468 4:143386031-143386053 ATTTGGGAGACTGAGATGGGAGG + Intronic
981597860 4:146447350-146447372 ATTTAGGAGGCTGAGATGGGAGG - Intronic
982225836 4:153165574-153165596 CTTTGGGAGGCTTAGATGGGAGG - Intronic
982433232 4:155348226-155348248 ACTTAGGAGGCTGAGATGGGAGG + Intronic
982545217 4:156724735-156724757 TTTTATGAGCTTCAGAGGGGAGG - Intergenic
982731330 4:158958241-158958263 ATTCAGGAGCCTGAGGTGGGAGG - Intronic
982856212 4:160385612-160385634 GTTTATGAGCTTCAGAGGGGAGG + Intergenic
983021171 4:162676828-162676850 ATTTAGGAGGCTGAAATGGGAGG + Intergenic
983179958 4:164636155-164636177 ATTTATAATCCTTTGATGTGTGG - Intergenic
983218480 4:165022529-165022551 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
983620218 4:169753432-169753454 ACTTAGGAGACTGAGATGGGAGG - Intronic
983986261 4:174063633-174063655 ATTCAGGAGGCTGAGATGGGAGG + Intergenic
983990453 4:174112800-174112822 ATTTTTGAGCCTTTGCTGTGGGG + Intergenic
984604135 4:181764936-181764958 CTTTAGGAGCCTGAGGTGGGAGG - Intergenic
984738658 4:183137605-183137627 ATTTAGGAGCCTGAAGTGGGAGG - Intronic
984846663 4:184114207-184114229 CTTTATGAGGCTAAGGTGGGTGG - Intronic
987839628 5:23206686-23206708 TTTTGTGAGCCTGAGGTGGGAGG - Intergenic
987850656 5:23349609-23349631 ATTTGTGATGCATAGATGGGAGG - Intergenic
987901354 5:24015851-24015873 ATTCATGAGGCTGAGGTGGGAGG + Intronic
988419408 5:30987387-30987409 ATTTAGGAGGCTGAGATGGGAGG - Intergenic
989446668 5:41537704-41537726 CTTTAGGAGGCTGAGATGGGTGG - Intergenic
989581398 5:43036708-43036730 ACTTATGAGGCTGAGAAGGGAGG + Intergenic
990442132 5:55857205-55857227 ATTTGGGAGGCTAAGATGGGAGG - Intronic
990620737 5:57556132-57556154 ACTCATGAGGCTGAGATGGGAGG - Intergenic
990923472 5:60993824-60993846 TTTTATGGGCCTCAGAGGGGAGG + Intronic
991064191 5:62408384-62408406 ATTAAGGAGACTGAGATGGGAGG + Intronic
991208217 5:64074540-64074562 ACTTAGGAGGCTGAGATGGGAGG + Intergenic
991982904 5:72251784-72251806 ATTTCCCAGCCTTGGATGGGTGG - Intronic
991985328 5:72279511-72279533 ATTTAGGAGGCGAAGATGGGAGG + Intronic
992381595 5:76242787-76242809 CTTTAGGAGCCTGAGGTGGGAGG + Intronic
992591901 5:78304321-78304343 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
992596473 5:78352593-78352615 AATTATGAGACTTAGATTAGAGG - Intergenic
992692143 5:79251338-79251360 ACTCAGGAGCCTGAGATGGGAGG - Intronic
992830302 5:80587354-80587376 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
993366562 5:87041283-87041305 ATTTATGAAGCTTAAATGGCTGG + Intergenic
993510847 5:88769887-88769909 CTTTAGGAGGCTTAGGTGGGTGG - Intronic
994689309 5:102997408-102997430 ACTCATGAGGCTGAGATGGGAGG + Intronic
995022802 5:107384855-107384877 ATTTGAGAGGCTGAGATGGGTGG - Intronic
995138310 5:108704619-108704641 ATTTGGGAGGCTAAGATGGGAGG + Intergenic
995258981 5:110079526-110079548 ATTTGGGAGGCTAAGATGGGCGG + Intergenic
995351104 5:111176633-111176655 ATTTGAGAGGCTGAGATGGGAGG - Intergenic
995509137 5:112890619-112890641 CTTTAGGAGGCTGAGATGGGTGG - Intronic
995874911 5:116780406-116780428 TTTTGTGAGGCTGAGATGGGTGG - Intergenic
995882101 5:116854502-116854524 ATTTAAGAGGCTGAGATGGGAGG - Intergenic
996359949 5:122635039-122635061 ATTTATGAAGCTTAGTTTGGCGG + Intergenic
996378402 5:122839729-122839751 ATTTAGGAGGCTGAGGTGGGTGG - Intergenic
996384753 5:122899515-122899537 ATTTGGGAGGCTAAGATGGGAGG - Intronic
996847115 5:127912171-127912193 CTTTAGGAGGCTGAGATGGGTGG - Intergenic
997327871 5:133036978-133037000 ACTTAGGAGCCTGAGGTGGGAGG + Intergenic
997925320 5:138025414-138025436 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
998026104 5:138818215-138818237 ATTTGGGAGGCTGAGATGGGAGG - Intronic
998538467 5:142956330-142956352 CTTTGTGAGGCTGAGATGGGAGG + Intronic
998663266 5:144264662-144264684 ATTCAGGAGGCTGAGATGGGAGG + Intronic
999218015 5:149952002-149952024 ACTTAGGAGGCTGAGATGGGAGG + Intergenic
999574461 5:152960124-152960146 ATTTAAGAGGCTGAGGTGGGCGG + Intergenic
999759070 5:154686347-154686369 GTTCATTAGACTTAGATGGGTGG + Intergenic
999760945 5:154700730-154700752 ATTTGGGAGCCTGAGGTGGGAGG - Intergenic
1000028322 5:157379560-157379582 ATTCAGGAGGCTGAGATGGGAGG + Intronic
1000426214 5:161093843-161093865 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
1001068223 5:168557901-168557923 ATTCAAGAGGCTGAGATGGGAGG - Intronic
1001276853 5:170357636-170357658 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
1001291793 5:170468766-170468788 ACTTAGGAGACTGAGATGGGAGG + Intronic
1001637874 5:173225518-173225540 ATTTGTGAGGCTGAGGTGGGAGG + Intergenic
1002035068 5:176462031-176462053 CTTTATGAGACTGAGGTGGGAGG + Intronic
1002503979 5:179666096-179666118 ACTTGGGAGCCTCAGATGGGAGG - Intergenic
1002693376 5:181066515-181066537 TTTTATAGGCCTTAGAGGGGAGG + Intergenic
1003342656 6:5236846-5236868 ATTTGGGAGCCTGAGGTGGGTGG + Intronic
1004175773 6:13338798-13338820 ATTCAGGAGGCTGAGATGGGAGG + Intergenic
1004251213 6:14024586-14024608 AGGTATAGGCCTTAGATGGGAGG + Intergenic
1004290520 6:14363060-14363082 ATTCAGGAGACTGAGATGGGAGG - Intergenic
1004304501 6:14487750-14487772 CTTTATGGGCCTCAGAGGGGAGG - Intergenic
1004718302 6:18240710-18240732 CTTTAGGAGGCTGAGATGGGAGG + Intronic
1004972266 6:20923766-20923788 ATTTGTGAGGCTGAGGTGGGTGG + Intronic
1005297482 6:24440642-24440664 ACTTGTGAACCTGAGATGGGAGG + Intronic
1005677329 6:28168495-28168517 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1005772198 6:29085187-29085209 ATTTAGGAGGCTGAGATGGGTGG + Intergenic
1005957092 6:30671789-30671811 ACTTAGGAGCCTGAGGTGGGAGG - Intronic
1006074583 6:31523475-31523497 ATTTAGGAGGCTGAGGTGGGAGG - Intergenic
1006306994 6:33228798-33228820 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1006462550 6:34170887-34170909 CTTTGTGAGGCTGAGATGGGTGG + Intergenic
1006579691 6:35069647-35069669 ATTTGGGAGACTTAGATGGGAGG - Intronic
1006687496 6:35848446-35848468 ATTTGGGAGGCTGAGATGGGAGG + Intronic
1007039161 6:38705535-38705557 ATTTGTGAGGCTGAGGTGGGTGG - Intergenic
1007099417 6:39234903-39234925 CTTTAGGAGACTTAGGTGGGTGG - Intergenic
1007849653 6:44791087-44791109 ACTCAGGAGGCTTAGATGGGAGG + Intergenic
1008076434 6:47150966-47150988 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1008519466 6:52349477-52349499 ACTCATGAGGCTAAGATGGGAGG + Intergenic
1008956777 6:57224190-57224212 ACTTAGGAGGCTGAGATGGGAGG + Intergenic
1008974508 6:57408937-57408959 ATAGATGAGGCTGAGATGGGAGG - Intronic
1009163398 6:60310445-60310467 ATAGATGAGGCTGAGATGGGAGG - Intergenic
1009281331 6:61755566-61755588 CTTTAGGAGGCTGAGATGGGCGG + Intronic
1009530197 6:64803391-64803413 GTTTATGGGCTTTAGAAGGGAGG + Intronic
1009609162 6:65916735-65916757 ATTCATGAGGCTGAGGTGGGAGG - Intergenic
1009610150 6:65930957-65930979 TTTTATGAGCCTCAGAGGGGAGG + Intergenic
1009718456 6:67430680-67430702 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
1009814273 6:68710740-68710762 ATTTCAGAGCCTTAGATTTGGGG + Intronic
1010213844 6:73384589-73384611 ATTTAGGAGCCCTAGGTGGGAGG + Intronic
1010345376 6:74804111-74804133 GTTTGGGAGCCTTAGTTGGGAGG + Intergenic
1010422317 6:75689116-75689138 ATTGAGGAGGCTGAGATGGGAGG + Intronic
1010848605 6:80744086-80744108 CTTTGGGAGCCTGAGATGGGAGG - Intergenic
1011252879 6:85391821-85391843 ATTTGGGAGACTGAGATGGGAGG - Intergenic
1011415236 6:87112278-87112300 ATTTAGGAGGCTGAGGTGGGAGG - Intergenic
1011530146 6:88312530-88312552 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1011962402 6:93107355-93107377 ATTTCTGAGGCTGAGGTGGGAGG - Intergenic
1012901329 6:105010252-105010274 ACTTATGAGGCTGAGGTGGGTGG + Intronic
1012942937 6:105435584-105435606 ATTTAGGAGGCTGAGGTGGGAGG - Intergenic
1013044778 6:106474233-106474255 ATTCAGGAGGCTGAGATGGGAGG + Intergenic
1013375804 6:109512970-109512992 ATTTAGGAGGCTGAGGTGGGAGG - Intronic
1013511912 6:110852461-110852483 CTTTAAGAGGCTGAGATGGGTGG - Intronic
1013573164 6:111450368-111450390 ATTCAGGAGGCTGAGATGGGAGG + Intronic
1013663550 6:112323418-112323440 ACTTAAGAGGCTGAGATGGGAGG - Intergenic
1013804665 6:113983849-113983871 TTTTGGGAGCCTTAGATGGGAGG + Intronic
1014022524 6:116607630-116607652 ATTTATGAAGCTTAGTTTGGTGG - Intergenic
1014306820 6:119753407-119753429 ATTTATGAAGTTTAGATTGGTGG + Intergenic
1014756227 6:125304099-125304121 ACTTGGGAGGCTTAGATGGGAGG + Intergenic
1015096203 6:129417426-129417448 TTTTATGGGCCTCAGAGGGGAGG + Intronic
1015143313 6:129958953-129958975 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
1015663722 6:135603763-135603785 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
1016161669 6:140889023-140889045 ATTTAGGAAGCTGAGATGGGAGG - Intergenic
1016200019 6:141395169-141395191 TTGTATGAGCCTCAGAGGGGAGG - Intergenic
1016240744 6:141927018-141927040 ATTTATGAACCTTTGAGTGGTGG - Intergenic
1016322358 6:142859350-142859372 ATTTGGGAGGCTGAGATGGGAGG + Intronic
1016435985 6:144037477-144037499 ACTTAGGAGGCTGAGATGGGAGG + Intronic
1016703507 6:147080202-147080224 ATTCAGGAGGCTAAGATGGGAGG - Intergenic
1016927090 6:149361512-149361534 GTTTCTGAGCCTGTGATGGGAGG + Intronic
1017476023 6:154794028-154794050 ACTTAGGAGGCTGAGATGGGAGG - Intronic
1017505987 6:155069025-155069047 ATTTGAGAGGCTAAGATGGGAGG - Intronic
1017675171 6:156805782-156805804 ACTTAGGAGGCTGAGATGGGAGG - Intronic
1018156077 6:160986505-160986527 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
1018359968 6:163057522-163057544 ATTTGGGAGGCTGAGATGGGAGG - Intronic
1018595940 6:165480475-165480497 ATTTAGGAGGCTGAGGTGGGAGG + Intronic
1018861470 6:167713321-167713343 ATTCATGGTCCTGAGATGGGAGG - Intergenic
1019340912 7:508449-508471 ATTCAGGAGGCTTAGGTGGGAGG + Intronic
1019368743 7:649682-649704 ATTCAGGAGGCTGAGATGGGAGG - Intronic
1020019206 7:4852555-4852577 ACTCAGGAGGCTTAGATGGGAGG - Intronic
1020138021 7:5597258-5597280 ACTCAGGAGGCTTAGATGGGAGG + Intronic
1020174325 7:5870217-5870239 ATTCAGGAGCCTGAGGTGGGAGG - Intergenic
1020291802 7:6728413-6728435 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1020435636 7:8159466-8159488 ATTTAGGAGGCTGAGGTGGGTGG + Intronic
1020533348 7:9362692-9362714 ACTTAGGAGACTGAGATGGGAGG + Intergenic
1021097271 7:16548029-16548051 TTTCATGGGCCTTAGAGGGGAGG - Intronic
1021627586 7:22609602-22609624 ATTTAGGAGACTGAGGTGGGAGG - Intronic
1021687268 7:23199184-23199206 ATTTGGGAGCCTGAGGTGGGAGG - Intronic
1022159615 7:27696241-27696263 ACTTAAGAGCCTAAGATAGGAGG - Intergenic
1023404089 7:39813289-39813311 ATTTAGGAGCCTGAGGTGGGAGG - Intergenic
1023508583 7:40925848-40925870 ATTTGGGAGGCTGAGATGGGGGG + Intergenic
1023699431 7:42877947-42877969 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
1023733741 7:43216896-43216918 CTTTAGGAGGCTGAGATGGGAGG - Intronic
1024024633 7:45400144-45400166 GTTTATGGGCCTCAGAAGGGAGG - Intergenic
1024134816 7:46395696-46395718 ATTATTCAGCCTTAGATAGGAGG + Intergenic
1024319784 7:48053558-48053580 ACTTGGGAGACTTAGATGGGAGG - Intronic
1024575347 7:50759082-50759104 ACTTAGGAGGCTTAGGTGGGAGG + Intronic
1025190038 7:56889344-56889366 ATTTAGAAGGCTGAGATGGGAGG + Intergenic
1025238493 7:57251594-57251616 CTTTAGGAGCCTGAGGTGGGCGG - Intergenic
1025300116 7:57812643-57812665 CTTTGGGAGCCTGAGATGGGAGG + Intergenic
1025477557 7:60944373-60944395 ATTTATGATCTTTAGATGATGGG - Intergenic
1025554567 7:62289281-62289303 ATTTATGATCTTTAGATGATGGG + Intergenic
1025560214 7:62363993-62364015 ATTTATGATCTTTAGATGATGGG - Intergenic
1025681901 7:63687577-63687599 ATTTAGAAGGCTGAGATGGGAGG - Intergenic
1025936590 7:66042866-66042888 ACTTACGAGGCTGAGATGGGAGG - Intergenic
1025947616 7:66116384-66116406 ACTTACGAGGCTGAGATGGGAGG + Intronic
1026025020 7:66737747-66737769 ACTTGTGAGCCTGAGGTGGGAGG + Intronic
1026046797 7:66911329-66911351 ACTTGGGAGCCTGAGATGGGAGG + Intergenic
1026157254 7:67837440-67837462 CTTTATGAGGCTGAGATGGGAGG + Intergenic
1026741066 7:72978908-72978930 CTTTAGGAGCCTGAGGTGGGTGG - Intergenic
1027102667 7:75386170-75386192 CTTTAGGAGCCTGAGGTGGGTGG + Intergenic
1027128364 7:75573141-75573163 TTTTATGGGCCTCAGAGGGGAGG - Intronic
1027441315 7:78221939-78221961 ATTTAGGAGGCTAAGGTGGGAGG + Intronic
1027524645 7:79252046-79252068 ATTCATGATGCTGAGATGGGAGG + Intronic
1027889300 7:83950401-83950423 ATTCGTGAGGCTGAGATGGGAGG + Intergenic
1028233332 7:88330665-88330687 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
1028416866 7:90589963-90589985 ACTCATGAGCCTGAGGTGGGAGG - Intronic
1028417249 7:90594414-90594436 ATTTAGGAGGCTGAGGTGGGAGG + Intronic
1028418737 7:90609266-90609288 CTTTAGGAGGCTGAGATGGGAGG - Intronic
1028520591 7:91726320-91726342 CCTTATGAGGCCTAGATGGGAGG + Intronic
1028796881 7:94912598-94912620 ATTTTAGAGCCTTATATGGAAGG - Intronic
1029164248 7:98575459-98575481 ATTCAGGAGGCTGAGATGGGGGG - Intergenic
1029176089 7:98665566-98665588 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1029177661 7:98676263-98676285 ATTTGAGAGACTGAGATGGGAGG - Intergenic
1029262606 7:99313431-99313453 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1029327629 7:99823477-99823499 TTTTATGGGCCCTAGAGGGGAGG - Intergenic
1029428180 7:100510593-100510615 ATTTGGGAGGCTGAGATGGGAGG + Intergenic
1029461308 7:100695156-100695178 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
1029698878 7:102233292-102233314 ACTTAGGAGGCTGAGATGGGAGG - Intronic
1029995853 7:105007511-105007533 ACTTAGGAGGCTTAGGTGGGAGG - Intergenic
1030331901 7:108279801-108279823 CTTTAGGAGGCTGAGATGGGAGG - Intronic
1030533197 7:110735549-110735571 ATTTGTGAGGCTGAGGTGGGTGG + Intronic
1030624882 7:111833296-111833318 CTTTAGGAGGCTGAGATGGGAGG + Intronic
1030641290 7:112009684-112009706 ATTTATGAGGATTATTTGGGGGG + Intronic
1030660737 7:112216550-112216572 CTTTATGAGGCTGAGGTGGGCGG - Intronic
1031265311 7:119572980-119573002 ATTTATGTGCCTCAGAGGAGAGG - Intergenic
1031295651 7:119999590-119999612 CTTTAGGAGGCTGAGATGGGTGG - Intergenic
1031836470 7:126685966-126685988 TTTTATGGGCCTCAGAGGGGAGG - Intronic
1032621767 7:133541606-133541628 ACTTGTGAGGCTGAGATGGGAGG - Intronic
1032858590 7:135857884-135857906 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1032860050 7:135868165-135868187 CTTTATGAGGCTGAGGTGGGAGG + Intergenic
1033134216 7:138771508-138771530 ATTCAGGAGGCTGAGATGGGTGG - Intronic
1034035094 7:147811339-147811361 CTTTGTGAGGCCTAGATGGGTGG - Intronic
1034481227 7:151321446-151321468 TTTTATGAGCCTCAGAGGGGAGG - Intergenic
1034834577 7:154339829-154339851 CTTTGGGAGCCTGAGATGGGCGG + Intronic
1035252382 7:157605781-157605803 ATTTATGGGCCTCAGAGGGGAGG + Intronic
1035457871 7:159021117-159021139 GTTTATGGGCCTCAGAGGGGAGG + Intergenic
1035715568 8:1751640-1751662 ATTCAGGAGGCTGAGATGGGAGG + Intergenic
1036489784 8:9214263-9214285 ATTTAGTAGGCTAAGATGGGAGG + Intergenic
1036700236 8:11008527-11008549 ACTTAGGAGCCTGAAATGGGAGG - Intronic
1036745849 8:11408760-11408782 CTTTAAGAGGCTGAGATGGGAGG + Intronic
1037247074 8:16847120-16847142 ACTTAGGAGGCTAAGATGGGAGG - Intergenic
1037407814 8:18562643-18562665 CTTTAAGAGGCTGAGATGGGCGG + Intronic
1038448531 8:27622316-27622338 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1038505117 8:28077456-28077478 ATTTGGGAGGCTAAGATGGGAGG + Intronic
1038755036 8:30332748-30332770 ATTGAGGAGGCTGAGATGGGAGG - Intergenic
1039460387 8:37738640-37738662 ACTCAGGAGGCTTAGATGGGAGG + Intronic
1039598006 8:38808519-38808541 ATTCAGGAGGCTGAGATGGGAGG - Intronic
1039715351 8:40102591-40102613 ATTTGGGAGGCTAAGATGGGAGG - Intergenic
1039875738 8:41584003-41584025 ATTTGGGAGGCTTAGGTGGGAGG - Intronic
1041073211 8:54145321-54145343 ACTCATGAGGCTGAGATGGGAGG - Intronic
1041263906 8:56045552-56045574 ATTTGGGAGACTGAGATGGGTGG - Intergenic
1041504808 8:58584743-58584765 ACTTAAGAGGCTAAGATGGGAGG - Intronic
1041638535 8:60171651-60171673 ATTTGGGAGTCTGAGATGGGAGG - Intergenic
1041800368 8:61791481-61791503 CTTTAAGAGGCTGAGATGGGAGG + Intergenic
1042154780 8:65832729-65832751 ACTTGTGAGGCTTAGGTGGGAGG - Intronic
1042341099 8:67680392-67680414 ATTTAGGAGGCTGAGGTGGGAGG + Intronic
1042533659 8:69838459-69838481 CTTTAAGAGGCTGAGATGGGAGG + Intergenic
1042627594 8:70775987-70776009 ATTTGGGAGGCTGAGATGGGAGG - Intronic
1042823896 8:72960763-72960785 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
1042879403 8:73470552-73470574 ATTTGGGAGGCCTAGATGGGAGG + Intronic
1042906395 8:73776582-73776604 CTTTAAGAGCCTGAGGTGGGTGG + Intronic
1042944443 8:74140906-74140928 ACTTCAGAGCCTGAGATGGGAGG + Intergenic
1043052499 8:75401296-75401318 GTTTATGAGGCCGAGATGGGTGG + Intergenic
1043082530 8:75784483-75784505 TTTTATGGGCTTCAGATGGGAGG + Intergenic
1043125237 8:76385642-76385664 ATTTGTGAGGCTAAGGTGGGTGG + Intergenic
1043674295 8:82930845-82930867 CTTTAGGAGCCTGAGGTGGGCGG - Intergenic
1043745577 8:83869734-83869756 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
1043939483 8:86180773-86180795 ACTTAGGAGGCTCAGATGGGAGG - Intergenic
1044231717 8:89786363-89786385 ATTAAGGAGGCTGAGATGGGAGG + Intronic
1044279678 8:90340816-90340838 ACTTCTGGGCCTTTGATGGGAGG - Intergenic
1044307984 8:90659613-90659635 ATTTGTGAGGCTGAGGTGGGAGG - Intronic
1044793066 8:95867567-95867589 ATTCAGGAGGCTGAGATGGGAGG + Intergenic
1044878131 8:96693223-96693245 AGTTATTAGCCTTAGAAAGGAGG + Intronic
1044999048 8:97864491-97864513 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1045028184 8:98109702-98109724 ACTTAGGAGGCTGAGATGGGAGG - Intronic
1045076070 8:98570235-98570257 ATTTGGGAGCCTGAGGTGGGAGG - Intronic
1045268980 8:100645718-100645740 ATTCAGGAGCCTGAGGTGGGAGG - Intronic
1045509341 8:102802120-102802142 ATTTGGGAGGCTGAGATGGGAGG + Intergenic
1045531880 8:102992873-102992895 ACTTGAGAGGCTTAGATGGGAGG + Intergenic
1045581586 8:103487085-103487107 ACTCAGGAGCCTGAGATGGGAGG - Intergenic
1045722337 8:105128209-105128231 ATTCATGAACCCTAGCTGGGTGG - Intronic
1045824201 8:106377427-106377449 ATTTAGGAGGCCAAGATGGGAGG - Intronic
1046040579 8:108898684-108898706 ATTTAGGAGGCTCAGGTGGGAGG + Intergenic
1046236338 8:111428342-111428364 ATTTGTGAGGCTAAGATGGGAGG - Intergenic
1046420680 8:113979950-113979972 ATAAATGAGGCTTAAATGGGAGG + Intergenic
1046756126 8:117974574-117974596 ACTTAGGAGGCTGAGATGGGAGG - Intronic
1046844652 8:118902315-118902337 CTTTCTGAGCCTAAGCTGGGAGG + Intergenic
1046937632 8:119900493-119900515 ACTCAGGAGCCTTAGATGGTAGG - Intronic
1047026568 8:120830933-120830955 ATTTAAGAGGCCAAGATGGGTGG + Intergenic
1047204263 8:122790849-122790871 CTTTGTGAGGCTGAGATGGGAGG - Intronic
1047451623 8:124970046-124970068 ACTTAAGAGGCTGAGATGGGAGG + Intergenic
1047949940 8:129924166-129924188 ACTCATGAGGCTGAGATGGGAGG + Intronic
1047978020 8:130150769-130150791 ACTTAGGAGGCTGAGATGGGAGG + Intronic
1048421692 8:134284008-134284030 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1049497194 8:142941573-142941595 ATTTGTGAGGCTGAGGTGGGAGG + Intergenic
1049824011 8:144655281-144655303 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
1049914058 9:299368-299390 ACTTGGGAGCCTGAGATGGGAGG - Intronic
1049969626 9:810233-810255 ATTCAGGAGGCTTAGATGGGAGG + Intergenic
1050106887 9:2174809-2174831 ACTTAGGAGGCTGAGATGGGAGG + Intronic
1050543253 9:6688050-6688072 CTTTAGGAGACTGAGATGGGTGG - Intergenic
1050904566 9:10987278-10987300 GTCTCTGAGCCTTTGATGGGAGG + Intergenic
1051372023 9:16366830-16366852 ATATGGAAGCCTTAGATGGGTGG - Intergenic
1052933345 9:34073601-34073623 ACTTAGGAGGCTGAGATGGGAGG - Intergenic
1052933638 9:34075786-34075808 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1053128196 9:35599608-35599630 TTTTATGGGCCTTAGAGGGGAGG - Intergenic
1053394074 9:37756461-37756483 CTTTGGGAGCCTGAGATGGGTGG + Intronic
1053436779 9:38080860-38080882 ATTCAAGAGGCTGAGATGGGAGG + Intergenic
1054149794 9:61592780-61592802 CTTTAGGAGGCTGAGATGGGTGG - Intergenic
1054469558 9:65523881-65523903 CTTTAGGAGGCTGAGATGGGTGG - Intergenic
1054867008 9:70013213-70013235 ATTCAGGAGGCTGAGATGGGAGG - Intergenic
1055028004 9:71742973-71742995 ATTTGGGAGGCTGAGATGGGAGG + Intronic
1055202720 9:73685916-73685938 ATTCAAGAGACTGAGATGGGAGG + Intergenic
1055321937 9:75090727-75090749 CTTTATGAGGCTGAGGTGGGAGG + Intronic
1055445067 9:76374398-76374420 ATTTGTGAGGCTGAGGTGGGAGG + Intergenic
1055639149 9:78306004-78306026 ATTTAGGAGGCTAAGGTGGGAGG - Intronic
1056068645 9:82963147-82963169 ATTTAGGAGGCTGAGGTGGGAGG - Intergenic
1056682851 9:88734355-88734377 ATTTGTAAGCGTTTGATGGGAGG + Intergenic
1057510808 9:95678343-95678365 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1057631417 9:96721867-96721889 ATTTCTGAGTCTTAGGTGGTAGG + Intergenic
1057809180 9:98244413-98244435 ATTTGGGAGGCTGAGATGGGCGG + Intronic
1057960299 9:99449358-99449380 ATTTAGGAGGCTGAGGTGGGAGG - Intergenic
1058270428 9:102966299-102966321 ATATAGGAGCCTGAGGTGGGAGG - Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1058818979 9:108711855-108711877 ATTCATGAGGCTGAGGTGGGAGG - Intergenic
1058910867 9:109518727-109518749 AATTATGAGCCCTGAATGGGAGG - Intergenic
1059622155 9:116018713-116018735 ATTCAAGAGACTGAGATGGGAGG - Intergenic
1060266460 9:122114267-122114289 ACTTAGGAGGCTGAGATGGGAGG + Intergenic
1060363507 9:122984470-122984492 ATTTGTGACCCTTAGATTGTAGG + Exonic
1060450411 9:123733386-123733408 ACTTAGGAGGCTGAGATGGGAGG - Intronic
1060537678 9:124404131-124404153 CTTTAGGAGCCTGAGGTGGGAGG - Intronic
1060567350 9:124604699-124604721 ATTAAGGAGGCTGAGATGGGAGG + Intronic
1060595661 9:124846980-124847002 ATTTGGGAGGCTGAGATGGGAGG + Intergenic
1060603852 9:124896821-124896843 ATTCATGAGGCTGAGGTGGGAGG + Intronic
1060830846 9:126715223-126715245 CTTTAGGAGCCTAAGCTGGGGGG + Intergenic
1061081366 9:128372550-128372572 ATTTCTGCCCCTTAGAAGGGGGG + Intronic
1061267373 9:129514590-129514612 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
1062184732 9:135211849-135211871 TTTTATGGGCCTCAGAGGGGAGG - Intergenic
1062557901 9:137124334-137124356 ATTTGGGAGGCTGAGATGGGAGG + Intergenic
1203366467 Un_KI270442v1:262448-262470 ATTCAGGAGCCTGAGGTGGGAGG - Intergenic
1185666394 X:1768656-1768678 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1185987682 X:4854004-4854026 CTTTAGGAGGCTGAGATGGGAGG - Intergenic
1187169344 X:16836147-16836169 ATTCAGGAGGCTGAGATGGGAGG + Intronic
1187351726 X:18525029-18525051 ACTTAGGAGACTGAGATGGGAGG - Intronic
1187927461 X:24263093-24263115 ATTTGGGAGGCTGAGATGGGAGG - Intergenic
1188301983 X:28515757-28515779 ATTTATGATCCTTACTTGTGTGG + Intergenic
1188387965 X:29584660-29584682 ATTCATGAGGCTGAGGTGGGAGG - Intronic
1189381005 X:40502028-40502050 ATTTGTGAGGCTGAGGTGGGAGG + Intergenic
1189885131 X:45535277-45535299 ACTCATGAGGCTCAGATGGGAGG + Intergenic
1190025918 X:46923119-46923141 ACTTGGGAGCCTGAGATGGGAGG - Intronic
1190239383 X:48645593-48645615 ACTTGGGAGCCTGAGATGGGAGG - Intergenic
1190706676 X:53034708-53034730 CTTTAGGAGACTGAGATGGGAGG + Intergenic
1190715135 X:53096715-53096737 ACTTAGGAGGCTGAGATGGGAGG + Intergenic
1190853385 X:54268378-54268400 ATTTGGGAGGCTGAGATGGGAGG + Intronic
1191221260 X:57990213-57990235 ATTTATGGACCTCAGAAGGGAGG - Intergenic
1191887748 X:65906353-65906375 GTTTGTGAGGCTGAGATGGGTGG + Intergenic
1192108663 X:68342076-68342098 ATTCAGGAGCCTGAGGTGGGAGG - Intronic
1192265319 X:69533705-69533727 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1192480053 X:71477397-71477419 ATTCAGGAGGCTGAGATGGGAGG - Intronic
1192620758 X:72677806-72677828 ATTTAGGAGGCTGAGGTGGGAGG + Intronic
1193108449 X:77704361-77704383 TTTTATGGGCCTCAGAGGGGAGG + Intronic
1193127493 X:77885171-77885193 ATTTGGGAGGCTGAGATGGGAGG - Intronic
1193127555 X:77885625-77885647 ATTTGGGAGGCTGAGATGGGAGG - Intronic
1193417241 X:81239555-81239577 AGTTATGGGCCTTAGAGAGGAGG + Intronic
1193745165 X:85269487-85269509 ACTCAGGAGCCTGAGATGGGAGG - Intronic
1194309991 X:92294384-92294406 ATTTGGGAGGCTGAGATGGGTGG - Intronic
1195380175 X:104263162-104263184 ATTTAGGAGGCTGAGGTGGGAGG - Intergenic
1195679778 X:107536106-107536128 ACTTAGGAGGCTGAGATGGGAGG + Intronic
1196209724 X:112982179-112982201 ACTTAGGAGGCTTAGGTGGGAGG + Intergenic
1196396983 X:115274937-115274959 ATTCAAGAGGCTTAGGTGGGAGG + Intergenic
1197129966 X:122994002-122994024 ACTCAGGAGGCTTAGATGGGAGG + Intergenic
1197325674 X:125090544-125090566 ATTTAGGAGGCTGAGGTGGGAGG + Intergenic
1197392462 X:125884158-125884180 CTTTGGGAGCCTGAGATGGGTGG - Intergenic
1197422097 X:126250258-126250280 ATTTATGAGGCTGAAGTGGGAGG - Intergenic
1197954140 X:131928893-131928915 CTTTGTGAGGCTGAGATGGGTGG - Intergenic
1197985438 X:132261946-132261968 CTTTAGGAGTCTGAGATGGGAGG + Intergenic
1198087966 X:133298490-133298512 ACTTAGGAGCCTGAGGTGGGAGG + Intergenic
1198484386 X:137072233-137072255 ATTCAGGAGCCTGAGGTGGGAGG - Intergenic
1199360017 X:146907136-146907158 TTTTATGGGCCTCAGAGGGGAGG + Intergenic
1199384883 X:147212596-147212618 ATTTGGGAGGCTTAGGTGGGTGG + Intergenic
1199998526 X:153043578-153043600 ATTTGGGAGGCTTAGATAGGAGG - Intergenic
1200618281 Y:5408682-5408704 ATTTGGGAGGCTGAGATGGGTGG - Intronic
1200777776 Y:7184907-7184929 ATTTAGGAGACTGAGGTGGGAGG + Intergenic
1201500007 Y:14631437-14631459 ATTCTGGAGCCTGAGATGGGAGG - Intronic
1201896101 Y:18994213-18994235 AATTTGGAGCTTTAGATGGGTGG + Intergenic
1202297671 Y:23376927-23376949 ACTCATGAGGCTGAGATGGGAGG - Intergenic
1202375955 Y:24237298-24237320 ACTTATGAGGCTGAGGTGGGAGG - Intergenic
1202494825 Y:25432820-25432842 ACTTATGAGGCTGAGGTGGGAGG + Intergenic
1202573138 Y:26293670-26293692 ACTCATGAGGCTGAGATGGGAGG + Intergenic