ID: 936744399

View in Genome Browser
Species Human (GRCh38)
Location 2:115557333-115557355
Sequence CCTACCATATAGAAGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936744399 Original CRISPR CCTACCATATAGAAGCAAGA AGG Intronic
901154928 1:7129226-7129248 CCAACCTAATAGAAGCCAGATGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907643106 1:56212438-56212460 ACTACAATATAAAAGCAAGTAGG + Intergenic
912504622 1:110147823-110147845 CCTACCATATCCAGGGAAGAGGG + Intergenic
917804708 1:178603267-178603289 TCAACCATATAGGAACAAGAAGG + Intergenic
1062988578 10:1793914-1793936 CCTATCATTAAGAAGGAAGATGG - Intergenic
1063210002 10:3871727-3871749 CCTGTCATACAGCAGCAAGAAGG + Intergenic
1066604259 10:37143834-37143856 CCCTTCATATAGAAGAAAGATGG + Intronic
1068207003 10:53867951-53867973 CCTACCATTTAGAATTAAAAAGG + Intronic
1070113328 10:73505567-73505589 CCTGGAATTTAGAAGCAAGAGGG + Intronic
1070535022 10:77370657-77370679 TCTACCACAGAGGAGCAAGAGGG - Intronic
1074078743 10:110151615-110151637 CCATCCATGTAGAAGGAAGAGGG - Intergenic
1074750313 10:116579824-116579846 CCTACCATATTGAAGCATTACGG + Intergenic
1078446037 11:11405553-11405575 AGAACCACATAGAAGCAAGAGGG + Intronic
1078892064 11:15566530-15566552 CCTACCATGAAGGAGAAAGAGGG - Intergenic
1085190739 11:74619608-74619630 CCCACCATTTAGTAGCAATATGG - Intronic
1085364229 11:75924090-75924112 CCTAGCATATAGCACCAAGCTGG + Intronic
1090067738 11:123518024-123518046 CCTGCCAGATGGAAGAAAGAAGG - Intergenic
1092477640 12:8832536-8832558 CTTACAAGTTAGAAGCAAGATGG + Intronic
1092641275 12:10513372-10513394 CCTAGTATAAATAAGCAAGAAGG - Intronic
1099168327 12:79334894-79334916 CCTAATATTTACAAGCAAGAAGG - Intronic
1100851408 12:98716176-98716198 CATGCCATATAGAGGCATGAAGG - Intronic
1104378906 12:128290119-128290141 CCTACCATATAAAACCCAGTAGG + Intronic
1105335230 13:19460949-19460971 TCTACCATAGGGAAGAAAGATGG - Intronic
1106769543 13:32948555-32948577 CCTCCCATGGGGAAGCAAGAAGG - Intergenic
1109395983 13:61760279-61760301 CCAACCTAATAGAAGCAACAAGG - Intergenic
1111787004 13:92800911-92800933 ACAACAATATACAAGCAAGAAGG - Intronic
1112647185 13:101347599-101347621 CCTACAATATAACAGTAAGATGG + Intronic
1113616865 13:111686338-111686360 CCTACCCCATAGGATCAAGATGG - Intergenic
1113622395 13:111771609-111771631 CCTACCCCATAGGATCAAGATGG - Intergenic
1120939216 14:89930628-89930650 GCAACCATCTTGAAGCAAGAGGG + Intronic
1121251272 14:92500996-92501018 CCTACCAAATAGCAGGTAGATGG + Exonic
1121903272 14:97714244-97714266 CCTATCAGAAAGAAGAAAGAGGG + Intergenic
1123963092 15:25427348-25427370 CCTATAAGATAGAAGGAAGATGG + Intronic
1123986226 15:25648647-25648669 CCTTCCATACACAAGAAAGACGG + Intergenic
1124851343 15:33341602-33341624 TCTACCATCTAGAAGCAGGAGGG + Intronic
1127048531 15:55054300-55054322 TCTACCATTAACAAGCAAGATGG - Intergenic
1128116580 15:65111143-65111165 CCTTCCATACAGAATCAGGAAGG + Intronic
1128212868 15:65914557-65914579 CCTCACATATATAACCAAGAGGG - Intronic
1137940548 16:52679615-52679637 GTTTCCATATAGGAGCAAGATGG + Intergenic
1140815996 16:78621497-78621519 ACTACCAAATAGAAGTAAAATGG - Intronic
1148622250 17:49043533-49043555 CCTACCATAAAGGAGCTATAGGG - Exonic
1150921616 17:69490091-69490113 CCTACCAACAAGAAACAAGAGGG - Intronic
1152331191 17:79674258-79674280 CTTCCCCTATAGAAGCCAGAGGG - Intergenic
1153685725 18:7542843-7542865 CCTTCCATCTAGAACCCAGATGG - Intergenic
1156635101 18:39018413-39018435 CCTGCCATAAAGGAGCAAGAAGG - Intergenic
1156753545 18:40492135-40492157 TCTAACACAAAGAAGCAAGATGG - Intergenic
1160354811 18:78218249-78218271 CCTTCCAAAGAGACGCAAGATGG + Intergenic
1160871015 19:1278073-1278095 CCTGCCTTAAAAAAGCAAGAAGG - Intronic
1166658133 19:44627218-44627240 CCTACCACATGGAAGCCAGGAGG - Intronic
1168369259 19:55818171-55818193 CCTTCCCTGGAGAAGCAAGATGG - Exonic
925079653 2:1053936-1053958 CCACTCATATGGAAGCAAGAGGG - Intronic
925726592 2:6878394-6878416 CCTGCCATTTGGAAGCAAGAAGG + Intronic
930222242 2:48756320-48756342 CTTACCATGTAGAAGCCAGAAGG - Intronic
936430749 2:112460370-112460392 CCAACCATAGAGAATCAACAAGG + Intergenic
936744399 2:115557333-115557355 CCTACCATATAGAAGCAAGAAGG + Intronic
939567715 2:143804194-143804216 CCTCTCATATGGAAGCATGAGGG + Intergenic
940803331 2:158156851-158156873 CCTCCCATATTGAAGCTGGATGG - Intergenic
942846264 2:180429370-180429392 CCTAACATGTAGAAGCAACATGG - Intergenic
943931496 2:193859505-193859527 CCTGAAATATAGAGGCAAGATGG - Intergenic
944016535 2:195046337-195046359 CTTAACATATAGAAGCACAATGG - Intergenic
944271913 2:197793757-197793779 TCTACAATATAGAGGGAAGATGG + Intergenic
947068942 2:226264340-226264362 CCTACCATATGGAAATTAGAAGG + Intergenic
947225435 2:227835427-227835449 CATACCATATAGAAAGAGGAAGG - Intergenic
947721563 2:232372607-232372629 CCTTCCATCCAGAGGCAAGAAGG - Intergenic
948016310 2:234693480-234693502 CCTTCCATACAGCAGCCAGAGGG - Intergenic
1169981707 20:11392213-11392235 CTTATAATGTAGAAGCAAGAAGG + Intergenic
1176738347 21:10574037-10574059 TCTACCATAGGGAAGAAAGATGG + Intronic
1178174143 21:30077025-30077047 CCTACCATAGAAAAGTAACAAGG - Intergenic
1182572552 22:31249684-31249706 CCTAGCTTAGAGAAGCCAGAAGG - Intronic
1183332383 22:37228553-37228575 CCTGCCACAGAGAAGCAAGCGGG - Intronic
949092492 3:45372-45394 CCTACTATATAACAGTAAGAAGG - Intergenic
951273785 3:20659859-20659881 CCTGCCATATATATGAAAGAAGG - Intergenic
952506274 3:34009291-34009313 CCTACCATATCTATGCTAGATGG - Intergenic
955985754 3:64572672-64572694 GATACCATAAAGAACCAAGAAGG + Intronic
956860180 3:73315002-73315024 CCTGCAATATAGAAGAAACATGG + Intergenic
957032752 3:75261450-75261472 CCTACTATATAACAGTAAGAAGG - Intergenic
957449649 3:80362541-80362563 CATAGCATAAAGAAGCAAAAAGG - Intergenic
957509254 3:81166689-81166711 CCTAGCATTTAAAGGCAAGAAGG - Intergenic
963937700 3:151071653-151071675 CCTATTATATAGAAACATGAAGG + Intergenic
967948483 3:194822665-194822687 CCAAGCATGAAGAAGCAAGAGGG - Intergenic
976419132 4:84818152-84818174 CCTACCATATAGAGGTAAGGCGG + Intronic
980560587 4:134468464-134468486 TCTACCATTTATAAGTAAGAGGG + Intergenic
981873393 4:149513155-149513177 CATACCCTTTAGAAGCAAAATGG - Intergenic
988606507 5:32683167-32683189 CATAGTATATAGTAGCAAGATGG - Intergenic
988726162 5:33928482-33928504 CTTAAAAGATAGAAGCAAGATGG + Intergenic
989982044 5:50656683-50656705 GCCACCATATAAAAGCATGAAGG - Intergenic
990536399 5:56727494-56727516 TCTATCATCAAGAAGCAAGAAGG - Intergenic
992695053 5:79277791-79277813 CCTAAAACACAGAAGCAAGAGGG - Intronic
994212508 5:97102223-97102245 TCTACCATATAAAAACAAGCTGG - Intronic
994734465 5:103535063-103535085 TCAACCATATTGAAGGAAGAGGG - Intergenic
998714140 5:144863189-144863211 CCTGCCTTCTAGAAACAAGAAGG - Intergenic
1000462837 5:161544649-161544671 CCTACCTTTTAGAAACAGGATGG + Intronic
1004133447 6:12943673-12943695 CCATTCATATAAAAGCAAGAAGG - Intronic
1008752987 6:54758765-54758787 TTTACCATATGGGAGCAAGACGG - Intergenic
1010016108 6:71106280-71106302 CCTGCCAAATGAAAGCAAGAAGG + Intergenic
1010300142 6:74250994-74251016 CCTACTATCTAGCAGAAAGAGGG - Intergenic
1011544819 6:88471643-88471665 CCTAATATATAAGAGCAAGAAGG + Intergenic
1014714028 6:124842747-124842769 CCTTCAATATTGAGGCAAGAGGG - Intergenic
1014791588 6:125678586-125678608 CTTACAATAAAGAAGGAAGAAGG - Intergenic
1015924768 6:138297562-138297584 TCTACCAGATAAAAGCAAAAGGG - Intronic
1016532229 6:145071559-145071581 TCTTCCTTATAGAAGAAAGAGGG - Intergenic
1020752249 7:12156912-12156934 AATACCTTATAGAAGCAATATGG - Intergenic
1021515518 7:21480544-21480566 CCAACCTTATAGAAACAAAAAGG - Intronic
1022195383 7:28061474-28061496 CTTACCATTTAGGACCAAGAGGG + Intronic
1023314055 7:38917171-38917193 GCTCCTATATAGCAGCAAGATGG + Intronic
1023382481 7:39623199-39623221 CTGACCCTCTAGAAGCAAGATGG + Intergenic
1024979919 7:55148738-55148760 CTTACCATCTAGAGGCAAGTTGG + Intronic
1035051327 7:156000608-156000630 CCAACCAGATAGAAGAAGGAAGG - Intergenic
1036602150 8:10271271-10271293 CCTACCATGGGGAAGCAAGCAGG + Intronic
1037052389 8:14392310-14392332 CATACCATCTAAAAGCTAGAAGG - Intronic
1037619086 8:20547217-20547239 CATTCCAAATAGAAGCAAGAGGG + Intergenic
1038069977 8:24003100-24003122 TCCACCATCTAGAAGCAAAATGG - Intergenic
1038107998 8:24458466-24458488 TCTACAATATAAAAGCAAAATGG + Intronic
1039616291 8:38957219-38957241 TCTACCATAAAAAAGGAAGATGG - Intronic
1040868367 8:52073993-52074015 CCTCTCAAATAGAAGAAAGATGG + Intergenic
1041164679 8:55079544-55079566 CCTACCATACAGTACCAAGTCGG + Intergenic
1044759189 8:95499254-95499276 CCAACCATTCAAAAGCAAGAGGG - Intergenic
1045622609 8:103998913-103998935 CCTGGCATATAATAGCAAGAAGG + Intronic
1046678154 8:117135459-117135481 CCTACAATTCAGAAGCAACAAGG - Intronic
1048140804 8:131792328-131792350 CCTACCATATAGCATCCAAAAGG - Intergenic
1049316912 8:141974270-141974292 CCTACCCCACAGAAGCATGATGG + Intergenic
1052021084 9:23525923-23525945 CCTAGCATAAAGAGGCAAGTTGG + Intergenic
1052723404 9:32200364-32200386 CCTACCATGTGGAAGGAAGCTGG + Intergenic
1058328417 9:103727306-103727328 CTTACCATATAGTAACTAGAAGG + Intergenic
1185844348 X:3423573-3423595 CTTTCCATACAGAAGAAAGAAGG - Intergenic
1195552804 X:106187183-106187205 CCTGGCATAAACAAGCAAGAAGG - Intronic
1196303121 X:114069245-114069267 CCTACCGTATGGAATAAAGAAGG - Intergenic
1199920202 X:152393514-152393536 CCTACAATATAAAAGCAGGTGGG + Intronic