ID: 936750039

View in Genome Browser
Species Human (GRCh38)
Location 2:115631014-115631036
Sequence CTGTAAATACATCTGATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3376
Summary {0: 1, 1: 12, 2: 197, 3: 1188, 4: 1978}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936750035_936750039 10 Left 936750035 2:115630981-115631003 CCAGCTCCTCTTTGTACTTCTGG 0: 86
1: 2481
2: 4505
3: 6313
4: 3264
Right 936750039 2:115631014-115631036 CTGTAAATACATCTGATCCTGGG 0: 1
1: 12
2: 197
3: 1188
4: 1978
936750037_936750039 4 Left 936750037 2:115630987-115631009 CCTCTTTGTACTTCTGGTAGAAT 0: 112
1: 2998
2: 7837
3: 2868
4: 922
Right 936750039 2:115631014-115631036 CTGTAAATACATCTGATCCTGGG 0: 1
1: 12
2: 197
3: 1188
4: 1978

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936750039 Original CRISPR CTGTAAATACATCTGATCCT GGG Intronic
Too many off-targets to display for this crispr