ID: 936750540

View in Genome Browser
Species Human (GRCh38)
Location 2:115635678-115635700
Sequence CTCTAGAAGCCCAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936750530_936750540 25 Left 936750530 2:115635630-115635652 CCGCACCTGTTCCATTTGATAAG 0: 1
1: 1
2: 0
3: 17
4: 138
Right 936750540 2:115635678-115635700 CTCTAGAAGCCCAATGGGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 181
936750531_936750540 20 Left 936750531 2:115635635-115635657 CCTGTTCCATTTGATAAGAAAGG 0: 1
1: 0
2: 2
3: 16
4: 205
Right 936750540 2:115635678-115635700 CTCTAGAAGCCCAATGGGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 181
936750533_936750540 14 Left 936750533 2:115635641-115635663 CCATTTGATAAGAAAGGTTATTT 0: 1
1: 0
2: 3
3: 43
4: 395
Right 936750540 2:115635678-115635700 CTCTAGAAGCCCAATGGGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936750540 Original CRISPR CTCTAGAAGCCCAATGGGGA GGG Intronic
903241673 1:21986781-21986803 TCCTAGAAGCTCAGTGGGGAAGG + Intronic
903245180 1:22009955-22009977 TCCTAGAAGCTCAGTGGGGAAGG + Intronic
903738440 1:25544494-25544516 CTCTGGAAGCCCGAGGGGAAAGG - Intronic
905140597 1:35840856-35840878 CTTTAGAAGGCCAAGGAGGAAGG - Intronic
906804214 1:48764466-48764488 GAATAGAAGCCAAATGGGGAAGG + Intronic
906863861 1:49394223-49394245 CACTAGAAAATCAATGGGGAAGG - Intronic
907496743 1:54850427-54850449 CTCCAGAGGCCAAATGGGTAGGG + Exonic
910139788 1:84014378-84014400 CTGTAGAAGCCTACTGGAGAAGG + Intergenic
911867458 1:103047149-103047171 CATTGGTAGCCCAATGGGGACGG + Intronic
915167999 1:153959237-153959259 CCCGAGGAGCCCAAGGGGGAAGG - Exonic
920103450 1:203533454-203533476 CTTTAGGAGGCCAAGGGGGACGG - Intergenic
922873005 1:228918134-228918156 TTCTAGCAGCTCAGTGGGGAAGG + Intergenic
1066351976 10:34644167-34644189 CTCTAGAAGCCCCAAAGGGCAGG - Intronic
1066544989 10:36489971-36489993 CTCTCCAAGCCCAGTGGGCAAGG + Intergenic
1069641132 10:69956167-69956189 ATCTAGAGACCCAGTGGGGAAGG - Intronic
1069647488 10:70013091-70013113 CTTTGGAAGGCCAAGGGGGAAGG - Intergenic
1069754229 10:70763548-70763570 CTGTAGGAGCCCAGTGGGAAAGG + Intergenic
1071752205 10:88492660-88492682 CTCTAGAAGGCCAAGGTGGGTGG - Intronic
1072708511 10:97699736-97699758 CTTTGGAAGCCCAAGGTGGAAGG - Intergenic
1074965661 10:118488789-118488811 CTCAAGCAGCCCAATGGAGAGGG - Intergenic
1075514002 10:123094932-123094954 CTCTACAAGCCCATCAGGGAGGG + Intergenic
1076070147 10:127482622-127482644 CTGTGGAAGCCCAAGGGTGAGGG - Intergenic
1077415954 11:2424358-2424380 CTCCAGAGGCCTAATGGGGAGGG - Intergenic
1077827931 11:5831025-5831047 CTCAAGAAGCCCAATGCCTAGGG - Intronic
1079243563 11:18737617-18737639 CTCTAGAAACCCAAAGAGAAAGG - Intronic
1080453435 11:32397561-32397583 CTCTAGGAGGCCAAGGTGGAAGG - Intronic
1080759728 11:35236816-35236838 GTCTGGAAGCCTAATGGGGCAGG - Intergenic
1083746402 11:64739475-64739497 TTCTGGAAGGCAAATGGGGACGG + Exonic
1084412791 11:69013910-69013932 CTCCAGGGGCTCAATGGGGAAGG - Intergenic
1084857309 11:71997471-71997493 CCCTAGAAACCCAATGCCGAAGG - Exonic
1085049877 11:73374984-73375006 CTCAATAAACCAAATGGGGAAGG - Intergenic
1086083189 11:82926546-82926568 CTCTAGAAGTTAAATCGGGACGG + Intronic
1086278059 11:85155624-85155646 CTTTAGAAGGCCAAGGAGGATGG + Intronic
1087292994 11:96340243-96340265 CTCAAAAAGCCCAAAGGAGATGG - Intronic
1095395383 12:41756849-41756871 CTCTATTAGCACAATGTGGAGGG - Intergenic
1095448579 12:42305811-42305833 CTCTGAGAGGCCAATGGGGATGG - Intronic
1096252856 12:50044519-50044541 CTCCAGCAGTCCAAGGGGGATGG + Intergenic
1096463239 12:51834408-51834430 CCACAGAAGCCCAATGGGGTGGG - Intergenic
1097026199 12:56057492-56057514 CTCTAGAAGCTGAAAAGGGAAGG - Intergenic
1098213733 12:68193883-68193905 CTCTAGAAGCTCAATGAAGCTGG + Intergenic
1098910582 12:76204529-76204551 CACTAGAAACCCAATGGAGAAGG + Intergenic
1100379661 12:94049739-94049761 ATCTGGAGGCTCAATGGGGAAGG + Intergenic
1101749462 12:107571525-107571547 CTCTAGAAGCCTAAAAGGGCAGG - Intronic
1103041254 12:117697308-117697330 CTCCAGAAGCCCTCTGGGGGTGG - Intronic
1103933762 12:124464408-124464430 CTCCAGGAGCCCAAAGTGGAGGG - Intronic
1104843179 12:131834307-131834329 TTCCAGAAGGCCACTGGGGAGGG - Intronic
1106794471 13:33190197-33190219 CTTTGGAAGGCCAATGAGGAAGG + Intronic
1107860898 13:44660174-44660196 CTCAGGAACCCCAATGAGGAAGG - Intergenic
1109960270 13:69620103-69620125 CTCTAGAAGGTCACTGTGGAGGG - Intergenic
1110197842 13:72811357-72811379 CTCTGGGAGCCCAATGTGGATGG + Intronic
1112033680 13:95478619-95478641 CCCAGGAAGCCAAATGGGGATGG - Intronic
1113592859 13:111512998-111513020 CTCTAGTAGCCCATTGGACACGG + Intergenic
1116881357 14:50172610-50172632 CTTTAGGAGTCCAAGGGGGAGGG - Intronic
1118253650 14:64185762-64185784 CTTTGGAAGCCCAAGGTGGACGG - Intronic
1118345498 14:64937825-64937847 CTTGAGAAGCCCAATGCTGAAGG - Intronic
1119240989 14:73059200-73059222 CTCTAGATGGCCAAAGAGGAAGG - Intronic
1121642629 14:95495929-95495951 CTTGAGAGGCCCACTGGGGAAGG - Intergenic
1124295220 15:28496153-28496175 CTCTATAACCTCAGTGGGGAAGG - Intergenic
1126842372 15:52729722-52729744 CTCAAGAAGCCCTTTGGGGCTGG - Intergenic
1126969353 15:54092667-54092689 GTTTAGAAGTCCATTGGGGAAGG + Intronic
1127968139 15:63939090-63939112 CTCTAGAAACCTAATGGGTGGGG - Intronic
1128350540 15:66885491-66885513 CTCTAGGTGCTGAATGGGGAAGG - Intergenic
1129716075 15:77851856-77851878 CTCTAGAAGCTCTCTGGGGAAGG - Intergenic
1130863480 15:87911461-87911483 TTCTAGAAACCCAATGGGGATGG + Intronic
1132082239 15:98876187-98876209 CTGTAAATGCCCAATGGAGATGG - Intronic
1135549168 16:23385248-23385270 CCCTAGTAGCCCAGTGGGGCTGG + Intergenic
1139962880 16:70728059-70728081 CACTAGAAGCCCAGTGGGCTGGG - Intronic
1141402496 16:83762621-83762643 TTCTGGAATCCCACTGGGGACGG + Intronic
1141534083 16:84666823-84666845 CTCTGGGAGGCCAAGGGGGACGG + Intronic
1141651389 16:85394913-85394935 CTCTGGAAGCTCAATGGGGCAGG + Intergenic
1147388090 17:40093387-40093409 CCCCAGAAGGCCGATGGGGAAGG + Exonic
1147845112 17:43399391-43399413 CTCTAGAAGCCCACTGTCCATGG + Intronic
1150106407 17:62465563-62465585 ATCTGGAAGCCAAATTGGGATGG + Intronic
1150132052 17:62674661-62674683 CTCTAGAAGCCCACTGGGGCTGG - Intronic
1150733546 17:67716304-67716326 CTCTAGGAGGCCAAGGGGGGAGG + Intergenic
1152016595 17:77755096-77755118 CTCAAGCAGCCCTATGGGGAGGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152790528 17:82276356-82276378 CTCTGGAAGGCCAAGGTGGATGG - Intergenic
1154044735 18:10894207-10894229 CTCTGGAAGGCCGATGGGGGCGG + Intronic
1156450938 18:37266226-37266248 CCCTGGAAGCTCCATGGGGAAGG + Intronic
1158382155 18:56943939-56943961 CCCTACAAGCCCACTGGTGAAGG - Intronic
1162740615 19:12771545-12771567 CTCTAGAGGCCAAATGGAGGGGG + Intronic
1163601698 19:18253093-18253115 CTCTAGAAGCCCTTTGGATATGG + Intronic
1168689225 19:58366865-58366887 CTCCAGAGGCCGAATGGGGCAGG - Intergenic
928975882 2:37085976-37085998 CTCAAGAAGCTCTATGGAGAAGG - Intronic
930381595 2:50636639-50636661 CTCTAGAAGCACAAAGAGGTAGG - Intronic
931039580 2:58282550-58282572 ATCTAGAAGCCAAAAGAGGAAGG - Intergenic
932652085 2:73569256-73569278 CTTTGGAAGGCCAATGGGGGTGG - Intronic
932939472 2:76145679-76145701 CTTTAGAAGGCAAATGGAGAAGG + Intergenic
933877039 2:86630231-86630253 CTTTAGAAGCCCAGGGTGGAGGG - Intronic
934086454 2:88513858-88513880 CTCTAGAAGGCCAAGGCGGGTGG - Intergenic
935043060 2:99453115-99453137 CTCTGGGAGGCCAAGGGGGAGGG + Intronic
936288975 2:111203857-111203879 CTCAAGAAGCCCCATAGAGAGGG - Intergenic
936750540 2:115635678-115635700 CTCTAGAAGCCCAATGGGGAGGG + Intronic
936914200 2:117623448-117623470 CTCAGGAAGCCCAAGGGGTAAGG + Intergenic
937336101 2:121063285-121063307 TTCTGGAATCCCAAGGGGGAAGG + Intergenic
937492851 2:122388050-122388072 CTCTAGGAGCAATATGGGGAGGG - Intergenic
941524858 2:166594678-166594700 CTTTGGAAGGCCAAGGGGGATGG + Intergenic
942249920 2:174038795-174038817 TCCCAGAAGCCAAATGGGGAGGG + Intergenic
946186240 2:217982129-217982151 CTCAAGCAGCCCTATGGAGAGGG + Intronic
946212210 2:218156326-218156348 ATCTAGAAGGTAAATGGGGAGGG - Intergenic
946804359 2:223455757-223455779 CTCCAGAAGGCTGATGGGGAAGG + Intergenic
947737880 2:232466727-232466749 CTCTAGGAGACCAAGGAGGAAGG - Intergenic
1169129438 20:3157674-3157696 CTCTAGAAGCCCCATTTAGATGG - Intronic
1171188116 20:23137712-23137734 CGCAAGAAGCCTAAGGGGGAAGG + Intergenic
1171767424 20:29297785-29297807 CTCGAGAAGCCCTAGTGGGAAGG + Intergenic
1175351776 20:58327061-58327083 CTCTGGAAGGCCAATGTGGGAGG + Intronic
1175504241 20:59470560-59470582 ATCTAGCAGCCCACTAGGGATGG - Intergenic
1178870202 21:36367255-36367277 CTCTTGGAGCCCAGTGAGGAGGG - Intronic
1180834549 22:18923327-18923349 CTCTAGAGGCCCTGTGGAGATGG + Intronic
1181457886 22:23070143-23070165 GGCCAGTAGCCCAATGGGGACGG - Intronic
1182560812 22:31157596-31157618 CTGTAGAAGCCCAAGGTGGGAGG + Intergenic
1183516449 22:38269586-38269608 CTTTAGAAGGCCAAGGTGGAAGG + Intronic
1184678595 22:46056839-46056861 CTCTAGAAGCTCAATCTAGAAGG - Intronic
1184703168 22:46191298-46191320 CTCCAGAAGCCCACAGTGGAGGG + Intronic
1203284638 22_KI270734v1_random:148626-148648 CTCTAGAGGCCCTGTGGAGATGG + Intergenic
951594756 3:24305953-24305975 TTTTAGAAGCCCATTGGGGGAGG - Intronic
952019215 3:28996950-28996972 CACTGGAAGCCAGATGGGGATGG + Intergenic
953323978 3:41996902-41996924 CTCTAGGAGGCCAAAGGGGAAGG - Intergenic
954330043 3:49884966-49884988 CTGCAGAAGCTCAATGGGGAAGG + Intergenic
954618871 3:51984470-51984492 CTCCAGAAGCCCACTGGGGCTGG + Intronic
955736151 3:62040683-62040705 CTCTGGAAGGCCAAGGCGGACGG - Intronic
956527263 3:70178763-70178785 CTCTGGGAGGCCAAGGGGGAAGG + Intergenic
956630042 3:71307684-71307706 CATTAGAAGCTCCATGGGGATGG - Intronic
961108990 3:124267868-124267890 CTCTGCAAGCCCCATGAGGAAGG + Intronic
961456962 3:127029131-127029153 CTGTGGAAGCCCCAAGGGGAGGG - Intronic
963030591 3:140970948-140970970 CTTTATAAGCCAAATGGGGTTGG - Exonic
963779881 3:149476337-149476359 ACCTAGAAGCCTACTGGGGAGGG - Intronic
965926330 3:173985113-173985135 CTCTGTAATCCCAATGGGGCTGG + Intronic
966210342 3:177446750-177446772 CTCTGGTACGCCAATGGGGATGG - Intergenic
968890477 4:3366126-3366148 CCCGAGAAGGGCAATGGGGAAGG + Intronic
973577566 4:52306042-52306064 CTCAAGCAGCCCTATGGAGAGGG - Intergenic
975460608 4:74649139-74649161 TTCTAGGGACCCAATGGGGAGGG - Intergenic
977770310 4:100850198-100850220 CACCATCAGCCCAATGGGGAGGG - Intronic
984782008 4:183534442-183534464 ATCTAGAAGTCAAATGGAGAAGG - Intergenic
987058458 5:14218682-14218704 CACAAGAAGCCCAGTGGGGCAGG + Intronic
988570239 5:32358112-32358134 CTCTGGAAGGCCAAGGTGGAAGG + Intronic
993061753 5:83047054-83047076 CTTTGGAAGGCCAAGGGGGATGG - Intergenic
993129924 5:83883518-83883540 TTCTACAAGCACAATGGGTAAGG + Intergenic
994241549 5:97427448-97427470 CTCTAGCACCACAATGGGGTGGG - Intergenic
996397068 5:123024080-123024102 CTCCAAAAGCCCAAGTGGGAAGG + Intronic
998227246 5:140336490-140336512 CGCTGGAAGCACGATGGGGAAGG - Intronic
998460441 5:142306029-142306051 CTATAGAAGCACAAGTGGGAAGG + Intergenic
999126208 5:149247940-149247962 CTCTGGAAGCCCAACGGGGCGGG + Intronic
999754655 5:154655358-154655380 TTTTAGAACCCCAATGAGGAAGG + Intergenic
1001565251 5:172695871-172695893 CTTAGGAAGCCCAGTGGGGAGGG - Intergenic
1006732819 6:36248954-36248976 CTAGAGAGGCCCAATGGGGAAGG + Intronic
1008618814 6:53251874-53251896 CTCTTGAAGGCCGATGGTGAAGG + Intergenic
1009747138 6:67831618-67831640 CTCTTATAGCCCAATGGGGGAGG - Intergenic
1013526996 6:110983584-110983606 CTCTAGGAGGCCAAGGTGGATGG - Intronic
1017822527 6:158059949-158059971 CCCTCAAAGCCCCATGGGGAGGG - Intronic
1018447598 6:163871974-163871996 CTTTGGAATCCTAATGGGGATGG + Intergenic
1019366681 7:636714-636736 CTGTAGAAGCCTGCTGGGGAGGG + Intronic
1019565276 7:1675922-1675944 CCCTAGAAGCCCAAGGGGCTGGG + Intergenic
1019717474 7:2546330-2546352 CTCGGGAAGCTGAATGGGGAGGG + Intronic
1019934919 7:4247880-4247902 CTGGAGGAGACCAATGGGGAGGG - Intronic
1023856787 7:44188992-44189014 CTTCAGAAGCCTACTGGGGAAGG - Intronic
1026724440 7:72859623-72859645 CTCTAGAAGTCGACTGGGCATGG + Intergenic
1028581718 7:92416021-92416043 CTCTAGAAGGGCTATGTGGATGG - Intergenic
1029243320 7:99180137-99180159 CTCAGGCAGCCCAATGGAGAAGG + Intronic
1030525387 7:110646927-110646949 CTCTAGAACCCCTATCGGCAGGG - Intergenic
1031142042 7:117953467-117953489 CTCTAGGTGGCCACTGGGGAAGG - Intergenic
1035141579 7:156768140-156768162 CTTTAGGAGGCCAAGGGGGATGG + Intronic
1038002187 8:23401737-23401759 CTCTAGATGGCCAGTGTGGAAGG - Intronic
1038411423 8:27362393-27362415 CTCTTCTAGCCCAATGGAGAAGG + Intronic
1039049539 8:33480473-33480495 TTTTAGAAGTCCTATGGGGAGGG - Intronic
1040476251 8:47780694-47780716 CTTTAGGAGGCCAATGGGGGCGG + Intronic
1041567362 8:59294284-59294306 TCCTACCAGCCCAATGGGGATGG - Intergenic
1041627577 8:60048145-60048167 CTCAAGCACCCCAATGGGGTTGG - Intergenic
1043283401 8:78498745-78498767 CTCTGGAAGCTCAATGTGGTGGG + Intergenic
1044774775 8:95676930-95676952 CCTTACAAGCCAAATGGGGAAGG - Intergenic
1045338000 8:101225363-101225385 CACTGGAAGACCAATGGGGTAGG + Intergenic
1048358464 8:133673723-133673745 CTTTATAAGCCAAATGGGGATGG + Intergenic
1049019151 8:139941904-139941926 CTGAAGGAGCCCCATGGGGAGGG + Intronic
1049283234 8:141761165-141761187 CTCCAGCAGCCCAAGAGGGAAGG - Intergenic
1053313095 9:37031807-37031829 CCCTATCTGCCCAATGGGGAGGG - Intronic
1055407186 9:75987398-75987420 CCCCACAAGTCCAATGGGGAAGG - Intronic
1057705445 9:97392089-97392111 CCCTAGAAGAGCAATGTGGAAGG - Intergenic
1057944074 9:99309394-99309416 CTCAAGGATCCAAATGGGGATGG + Intergenic
1059277822 9:113110254-113110276 CCCTAGATACCCAGTGGGGAGGG + Intergenic
1059278429 9:113114297-113114319 CCCTAGATACCCAGTGGGGAGGG - Intergenic
1060009392 9:120030284-120030306 CTCTAGAAGCTGAAAGGGGGAGG - Intergenic
1061787425 9:133038344-133038366 CTCTGGGTGCCCAATGGGCAGGG + Intronic
1062309352 9:135927549-135927571 CTCTTGGCCCCCAATGGGGATGG - Intergenic
1186424749 X:9455151-9455173 TTCTACAAGCCCACTGTGGAAGG + Intergenic
1191152021 X:57229340-57229362 TACTAGAAGCCCTATTGGGAAGG - Intergenic
1192314891 X:70043818-70043840 CTCAAGAGGCTCAATGTGGATGG + Intronic
1194607100 X:95994283-95994305 CTCTAAAGGCCCACTGGGAAGGG + Intergenic
1195318714 X:103703685-103703707 CTTTGGAAGGCCAAGGGGGAAGG + Intergenic
1195758196 X:108220058-108220080 CTGTAGAAGCATAATGGAGAGGG - Intronic
1196022812 X:111007872-111007894 CTCTAGAAGACAAATGAGAAAGG + Intronic
1197963182 X:132028106-132028128 CTTTGGAAGGCCAATGTGGATGG - Intergenic
1199754291 X:150850041-150850063 GTTTACAAGCCCAGTGGGGAAGG + Intronic
1200277412 X:154747555-154747577 CTTTAGAAGGCCAAGGTGGAAGG + Intronic
1201077670 Y:10199595-10199617 CTCGAGAAGCCCTAGTGGGAAGG - Intergenic
1201763727 Y:17562084-17562106 CTCCAGAACCCCACTGGGCAGGG + Intergenic
1201837826 Y:18343906-18343928 CTCCAGAACCCCACTGGGCAGGG - Intergenic