ID: 936752442

View in Genome Browser
Species Human (GRCh38)
Location 2:115661450-115661472
Sequence TCTAAGTTTTGTTAGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936752442 Original CRISPR TCTAAGTTTTGTTAGGTGAA TGG Intronic
900976372 1:6019284-6019306 TTTAATTTTTTTTAGGAGAAGGG - Intronic
901330317 1:8402652-8402674 TTTATGTTTTGCTTGGTGAAGGG + Intronic
901697886 1:11022837-11022859 TATAAGTTTTGTTACATGAAAGG + Exonic
902078844 1:13807303-13807325 TCTACTATTTGTCAGGTGAACGG - Intronic
902711939 1:18246429-18246451 GCTGACTTGTGTTAGGTGAAGGG - Intronic
903142415 1:21346744-21346766 TGTAGGTTTTGTGAGGTCAAGGG + Intergenic
904180571 1:28663871-28663893 TCTGAGTTCTGTAAGGTGAGTGG + Intergenic
907938849 1:59067491-59067513 GCTAAGTTCTGTCAGGTGATGGG - Intergenic
909052113 1:70778617-70778639 TATAATTTTTTTTAAGTGAAAGG + Intergenic
909390825 1:75119596-75119618 GCTAATTTTTGTTAGGTGGTTGG - Intergenic
909529087 1:76661273-76661295 TCTGAGTTATTTTATGTGAAGGG - Intergenic
909835457 1:80248915-80248937 TTGAAGTTTTGTTAGAAGAATGG + Intergenic
910478187 1:87630931-87630953 GCTAACTTTTGTAAGGGGAAGGG - Intergenic
914400282 1:147313150-147313172 TCTAAATTTTGTCAGTTTAATGG - Intergenic
916261164 1:162844010-162844032 TGTAAGTTTTGTTCAGTGTAAGG + Intronic
918776939 1:188644218-188644240 TGTATATTTTGTTTGGTGAAGGG + Intergenic
920336222 1:205247140-205247162 CCTCAGCTTTGTTAGGTGTATGG + Intronic
1070898455 10:80006108-80006130 TTTAAGTCTTGTTATGTGGATGG - Intergenic
1071690642 10:87816342-87816364 TCTAATTATTGTGAAGTGAATGG - Intronic
1073895631 10:108153100-108153122 TCTAAGGTTTGTTACCTGAGAGG - Intergenic
1074190600 10:111131929-111131951 TGTTAGTTTTCTTAGGTTAATGG + Intergenic
1076292582 10:129358869-129358891 TACAACTTTTGTAAGGTGAAGGG + Intergenic
1084882345 11:72180693-72180715 AGTATGTTTTGTTAGGAGAAAGG - Intergenic
1086418420 11:86613074-86613096 GTTAATTTTTGTAAGGTGAAAGG + Intronic
1087070058 11:94069935-94069957 TCTCAGTGTTGGTAGATGAATGG - Intronic
1089674481 11:120080710-120080732 TCCAAGTTCTGTTAGGAGAGGGG - Intergenic
1090633441 11:128670630-128670652 TATAATTTTTTTTAAGTGAATGG - Intergenic
1095593736 12:43936074-43936096 TGAAAGTTTTTTTAAGTGAAGGG + Intronic
1099147302 12:79063090-79063112 TATCAGTTTTGTGAGGTTAAAGG - Intronic
1099546928 12:83994934-83994956 TATAAGTTTTTTTAGGTCTATGG - Intergenic
1106167267 13:27259248-27259270 ACTAAGTTTTCTTACGTGGAAGG + Intergenic
1109273211 13:60276623-60276645 AATAAGTTTTGTTACATGAAAGG + Intergenic
1109381338 13:61564418-61564440 ACTAAGTGATGCTAGGTGAAAGG - Intergenic
1111774923 13:92648773-92648795 GCTAAGTTTTGTTGAATGAAGGG + Intronic
1115153346 14:30310814-30310836 TCTAAATTTTATTAATTGAAAGG + Intergenic
1116266639 14:42699674-42699696 TCTGATTTTTGTTAGTTTAATGG - Intergenic
1119089594 14:71769077-71769099 TCTTAATTTTGTTTGGGGAATGG - Intergenic
1120063421 14:80011846-80011868 ACTAAGGTTTTTTTGGTGAAAGG - Intergenic
1120704452 14:87732903-87732925 TCTAAGGTCTGTAAGATGAAGGG + Intergenic
1121841865 14:97141367-97141389 TTAAAGTTTAGTTAGATGAAGGG - Intergenic
1124091699 15:26610246-26610268 CCTAATTTTTGTTGGTTGAAGGG + Intronic
1124789288 15:32712264-32712286 TCTAAATTTTTTTTGGTGGAGGG - Intergenic
1124968269 15:34456709-34456731 ACTAAGTTTTGTTGGATGAAGGG + Intergenic
1125118309 15:36121521-36121543 ACTAGATTTTGTTATGTGAAAGG - Intergenic
1132190933 15:99858150-99858172 ACTAAGTTTTGTTGGATGAAGGG - Intergenic
1133520031 16:6548408-6548430 TTTAGGTTTTGTTATGAGAAGGG + Intronic
1137070654 16:35901771-35901793 TCTGAGTTTGGTTTGGTGAGAGG - Intergenic
1138801601 16:60037629-60037651 TGTATGTTTTTATAGGTGAAGGG - Intergenic
1141194514 16:81850221-81850243 CATCAGTTTTGTTAGGTGTAAGG + Intronic
1142955534 17:3519039-3519061 TCTGGGCTTTGTTAGGTGGAAGG - Intronic
1146307474 17:31741662-31741684 TCTAAGTTTGCTTTGGTCAATGG - Intergenic
1146512462 17:33461922-33461944 ATAAAGTTTTGTTAGATGAATGG - Intronic
1147195666 17:38765075-38765097 TCAAAGTTATGTCAGGTGAGTGG + Intergenic
1149081331 17:52661209-52661231 TCTAAGTTTTGGCTGTTGAAAGG + Intergenic
1150120346 17:62596043-62596065 TCAAATATTTGTTAAGTGAATGG - Intronic
1151118895 17:71770296-71770318 TCTGAGTTTTAGTAGGAGAAAGG + Intergenic
1151144518 17:72028547-72028569 TCTCTGTTTTGTTTTGTGAACGG + Intergenic
1151775760 17:76200603-76200625 TTTCAGTTTTGTGAGATGAAAGG + Intronic
1153012864 18:555633-555655 TATAAGTTTTGCTTGGAGAATGG + Intergenic
1157063866 18:44324344-44324366 TCTAAGTTTTGTTTGATGGCTGG + Intergenic
1158296331 18:56001011-56001033 TCTTAATTTTTTTAAGTGAAGGG + Intergenic
1158862793 18:61609259-61609281 TCTATGTTTTATTACATGAAAGG + Intergenic
1159755520 18:72359236-72359258 TACATGTTTTGTTAGGTAAAAGG - Intergenic
1163379462 19:16955513-16955535 TGTCAGTTTTGTAAGATGAAAGG + Intronic
925876769 2:8317956-8317978 CCTAGGTTCTGTTAGGTGACTGG - Intergenic
926354733 2:12031137-12031159 TCTAAAGCTTGTTAGGTGATGGG + Intergenic
926552958 2:14322044-14322066 TTTAATATTTGTTAGGTGAATGG - Intergenic
927885400 2:26715090-26715112 TCTAACTAATGTTAGTTGAATGG - Intronic
929520789 2:42648607-42648629 TCTAGAGTTTGTTAGGTGATGGG - Intronic
930707456 2:54518948-54518970 TCTAAATTTTATTATGTGTATGG + Intronic
930722503 2:54651258-54651280 TCTAAGTCTAATGAGGTGAAGGG - Intronic
931980796 2:67692191-67692213 TCTCAGTTTTGCAAGATGAAAGG + Intergenic
934276863 2:91580686-91580708 TGATAGTTTTGTTAGGTGACAGG + Intergenic
935885873 2:107618432-107618454 TCTCAGTTTTGTGGGGGGAAGGG - Intergenic
936752442 2:115661450-115661472 TCTAAGTTTTGTTAGGTGAATGG + Intronic
937555293 2:123146858-123146880 ACAAAATTGTGTTAGGTGAATGG + Intergenic
938894079 2:135733653-135733675 TCAAAGTTTTAATAAGTGAAGGG + Intergenic
940286907 2:152041573-152041595 TCTGAGTTTTGATAGGAGACTGG + Intronic
940359217 2:152779475-152779497 TTTAAATTCTGTTAGGTGGAAGG + Intergenic
940652831 2:156454605-156454627 TCAAGGTTTAGTTTGGTGAAAGG + Intronic
942399602 2:175587885-175587907 TCTATTTTTTTTTAGGTGAGTGG + Intergenic
942953839 2:181751322-181751344 TCTAATATTTGTTAGATCAATGG + Intergenic
943237641 2:185343098-185343120 AATATGTTTTGTAAGGTGAAAGG - Intergenic
943974731 2:194459218-194459240 TCTAAGTTTCCTTAGTTGTATGG - Intergenic
944875267 2:203958182-203958204 TCTAAGTGTTTTTTGTTGAAGGG + Intronic
945535660 2:211014764-211014786 TCTGAGTTTTGGAAGGTTAAAGG - Intergenic
945890177 2:215422380-215422402 TCTAAGTGCTGTCAGGTGAAGGG + Intronic
947293227 2:228600663-228600685 TCAATTTTCTGTTAGGTGAATGG + Intergenic
948432518 2:237928969-237928991 ACAAAATTCTGTTAGGTGAAAGG + Intergenic
948478017 2:238233147-238233169 TATAAGTTTTGTTACATGAAAGG + Intergenic
1168734311 20:116649-116671 TCTCAGTTGTTTCAGGTGAAGGG - Intergenic
1170319249 20:15077137-15077159 TTTAAATTCTGTTAGTTGAAAGG + Intronic
1170382833 20:15780631-15780653 TCTAACTATTGTTTGATGAATGG + Intronic
1172184967 20:33025830-33025852 TATATGTTCTTTTAGGTGAAGGG + Intergenic
1172749639 20:37241751-37241773 TCTCAGTTCTGTTAGGAGCAAGG - Intergenic
1179252777 21:39686904-39686926 TCTAAGGTTTGTAAACTGAACGG - Intergenic
1180019204 21:45110271-45110293 TTTAAGGTTTGTTTCGTGAATGG - Intronic
1180615923 22:17127073-17127095 TCTAATTGTTGTGAGGTCAAAGG - Intronic
1180929132 22:19577086-19577108 TCTGGGTTTTGTTAGGGGAGGGG + Intergenic
1183447399 22:37867342-37867364 TCTAATTTTTGTCAGTTCAATGG + Intronic
949194773 3:1291460-1291482 TGTAATTTTTGTTAAGTGAAAGG + Intronic
949568079 3:5263896-5263918 TCTTAGGTTTGTTAGGAGAAGGG + Intergenic
949642692 3:6056849-6056871 TGTAACTTCTGTTAGCTGAATGG + Intergenic
950161721 3:10765395-10765417 TCCAAGTTTTGTTATCTGTAAGG + Intergenic
951764443 3:26181871-26181893 TCTATGTGTTGTTGGATGAAAGG - Intergenic
952357708 3:32600099-32600121 TCTACCTTTTGGTAGGTGAGTGG + Intergenic
955977952 3:64496410-64496432 TCACAGTTTTATTGGGTGAATGG - Intergenic
959396749 3:105849859-105849881 ACTTAGTTTTATTAGGTCAATGG + Intronic
959569724 3:107869974-107869996 TCTAAGTATTTTTGGGTGTATGG + Intergenic
960522319 3:118669522-118669544 TCTAAGGTCAGATAGGTGAAAGG + Intergenic
965201983 3:165670919-165670941 TCTAACTTTTGTTTGGCAAAGGG - Intergenic
967097158 3:186186568-186186590 TCAAAGTTTTGATAGGTGGATGG - Intronic
968924909 4:3542025-3542047 TATAAGAATTGGTAGGTGAATGG + Intergenic
969033894 4:4235694-4235716 TGATAGTTTTGTTAGGTGACAGG - Exonic
970965055 4:21918703-21918725 TCTTATTTTTTTTAGCTGAATGG - Intronic
971288718 4:25314988-25315010 TTTCAGTTTTGTTAGGTTTATGG + Intronic
974596719 4:64022994-64023016 TCTCTGTTTTCTCAGGTGAAGGG - Intergenic
974629600 4:64467694-64467716 TCTAGGTTTGGTTATATGAAAGG - Intergenic
975074869 4:70193372-70193394 CCTAAGTTTTGTTAAATAAATGG - Intergenic
976001405 4:80377294-80377316 TGTAAATTTTGTTAGGTAAGAGG + Intronic
977132263 4:93255282-93255304 CCTAAGTTTTGTGGGTTGAATGG + Intronic
977491461 4:97717784-97717806 TCAAAGTGGTTTTAGGTGAAGGG - Intronic
978615436 4:110589052-110589074 TCTAATTTTTCTTAGGTATATGG + Intergenic
978732567 4:112046596-112046618 TTTAACTTTTGTTAGGTCCAGGG + Intergenic
978918697 4:114155053-114155075 CCTATGTTTTGCTAGGAGAATGG + Intergenic
981987932 4:150880219-150880241 GCCAAGTTTTGTATGGTGAAAGG - Intronic
982438563 4:155406220-155406242 TGAAAGTTTTGTCATGTGAAAGG - Intergenic
983310588 4:166055804-166055826 TGTATGTATTGTGAGGTGAAAGG + Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
985086482 4:186318192-186318214 TCTAGGATTTGTGAGGTGGAAGG + Intergenic
988133300 5:27135686-27135708 TTGAAGTTTTGTTAGGTTTAGGG + Intergenic
988993027 5:36690086-36690108 TGTGAGTTCTGTTAGCTGAACGG + Intergenic
990273625 5:54172593-54172615 TCTAAGTATTTAGAGGTGAAGGG + Intronic
990732017 5:58819457-58819479 TCTAAGTTTTCCTTGGTTAAAGG + Intronic
995450362 5:112293451-112293473 TCTAGGTTTAGGGAGGTGAAGGG - Intronic
995684774 5:114760187-114760209 TATAAGTTATGTTAGGTTTATGG - Intergenic
998314234 5:141166356-141166378 ACTAAGTTGTGTTAGATTAAGGG + Intergenic
1003025260 6:2549529-2549551 ACTACGTTTTGTTCCGTGAAGGG + Intergenic
1006548072 6:34795909-34795931 TATGAGTCTTGTTAGGGGAAAGG + Intronic
1009843206 6:69103131-69103153 ACTCAGTTTTGTAAGGTGGATGG + Intronic
1009907209 6:69884736-69884758 TCTAATTTTTGGAAGGAGAAGGG + Intronic
1011220161 6:85046644-85046666 TCTAAGTTTTGTTAACAGCAAGG + Intergenic
1011673883 6:89712227-89712249 TCTAAGTCTTGCAAGGTAAAAGG + Exonic
1012762085 6:103315432-103315454 TTTAATTTTTATTAGGTGTAAGG + Intergenic
1015800544 6:137057857-137057879 TATAAGTCTTGTTATGTGTAAGG - Intergenic
1016038773 6:139410378-139410400 TGTATTCTTTGTTAGGTGAAAGG + Intergenic
1020381234 7:7548976-7548998 AATAAGTATTGTTAGATGAATGG - Intergenic
1022087995 7:27087800-27087822 TCTAAGATTTGAAAGGGGAAAGG - Intergenic
1023979192 7:45056986-45057008 TGTAAATATTGTTAGGTAAATGG + Intronic
1024168531 7:46759730-46759752 TCTGGGTTTTGGTAGGTGGATGG - Intronic
1026425106 7:70283242-70283264 TTTATGTTTTGTTTTGTGAAAGG + Intronic
1027408676 7:77890072-77890094 TCAAAGATTTGATAGGTGAGAGG - Intronic
1027614419 7:80403688-80403710 TTTATGTTTTGTTCTGTGAATGG + Intronic
1028041207 7:86057580-86057602 TCTATGTTGTTTCAGGTGAAAGG + Intergenic
1030562787 7:111111862-111111884 TTTAAGTTAAGTTAGGTGACAGG + Intronic
1030595377 7:111532031-111532053 TCTAAGTTTTGATTTTTGAAAGG - Intronic
1030872359 7:114772893-114772915 TCTGAGAATTGTAAGGTGAATGG + Intergenic
1031176025 7:118351566-118351588 TTCAAGTTTTATTAGCTGAAAGG + Intergenic
1031309221 7:120173482-120173504 TTTAAGTATAGTTAAGTGAAAGG + Intergenic
1031748841 7:125543342-125543364 TCTAAGTTTTATTTATTGAAAGG - Intergenic
1037120460 8:15279647-15279669 TCTAAGTGCTGTCAAGTGAAAGG + Intergenic
1038902831 8:31863348-31863370 AGTAAGTTTTATTAGGGGAAGGG + Intronic
1040601160 8:48884937-48884959 ACCAAGTTTTGTTGAGTGAAAGG + Intergenic
1040754006 8:50748339-50748361 TTTACATTTTGCTAGGTGAAGGG + Intronic
1041443763 8:57927850-57927872 TCTAAGATTTGGCAAGTGAATGG - Intergenic
1042016177 8:64315445-64315467 TCTTATTTGTGTTAGGAGAAGGG - Intergenic
1043721984 8:83556513-83556535 TCCAAGTATTTTTAGATGAATGG + Intergenic
1051870700 9:21734710-21734732 TTTAATCTTTTTTAGGTGAAAGG + Intergenic
1052214398 9:25948667-25948689 TCTTTGTTTTTATAGGTGAAGGG + Intergenic
1052581853 9:30367094-30367116 TTTAATTTTTGTAATGTGAAAGG + Intergenic
1053799956 9:41757898-41757920 TGTAAGAATTGGTAGGTGAATGG + Intergenic
1054145230 9:61556933-61556955 TATAAGAATTGGTAGGTGAATGG - Intergenic
1054188387 9:61970046-61970068 TGTAAGAATTGGTAGGTGAATGG + Intergenic
1054464917 9:65487806-65487828 TGTAAGAATTGGTAGGTGAATGG - Intergenic
1054650138 9:67618575-67618597 TGTAAGAATTGGTAGGTGAATGG - Intergenic
1054794439 9:69286714-69286736 ACTATGTTTTGTTAGAAGAAAGG + Intergenic
1054961887 9:70978423-70978445 TCTGAGTTATGTTAGCTGACTGG - Intronic
1056210613 9:84361541-84361563 TCTCTGATTTGTCAGGTGAAAGG + Intergenic
1057420990 9:94912254-94912276 TCTTAGCTTTGTTAGGTGTTTGG + Intronic
1061621571 9:131814333-131814355 TCTTAGTGCTGTTAGGTGGAGGG + Intergenic
1186446788 X:9636575-9636597 TCTGGTTTTTCTTAGGTGAATGG + Intronic
1186986995 X:15028110-15028132 ACAAAGTTTTGTTACTTGAAAGG + Intergenic
1192537930 X:71944410-71944432 TCTAAGATTTGGTAGGTCTAAGG + Intergenic
1193058546 X:77180424-77180446 TCTATGTTTTGATAGGTGTTTGG - Intergenic
1193205661 X:78744940-78744962 TCTAACATTTGTAAGGTGGAAGG - Intergenic
1193539644 X:82755539-82755561 TCTAAGTTTAGTTAATTCAATGG + Intergenic
1197699003 X:129582927-129582949 TCTTAGTTCTGCTAGGTAAAAGG - Intronic
1200163919 X:154023229-154023251 TGTAATTTTTGGTGGGTGAAAGG - Intronic
1200309331 X:155061497-155061519 TATGAGGTATGTTAGGTGAAAGG - Intergenic
1201793668 Y:17871186-17871208 TCTAACTTCTGTTAGGAGATTGG - Intergenic
1201807886 Y:18034800-18034822 TCTAACTTCTGTTAGGAGATTGG + Intergenic