ID: 936752928

View in Genome Browser
Species Human (GRCh38)
Location 2:115668085-115668107
Sequence ACTACTGTACTGAAGATATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936752928_936752929 30 Left 936752928 2:115668085-115668107 CCATATATCTTCAGTACAGTAGT 0: 1
1: 0
2: 1
3: 9
4: 155
Right 936752929 2:115668138-115668160 TCCAGAAATTACCTTTTTTTTGG 0: 1
1: 1
2: 2
3: 49
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936752928 Original CRISPR ACTACTGTACTGAAGATATA TGG (reversed) Intronic
910009240 1:82440253-82440275 ACTGATGAACTGAAGAGATAAGG + Intergenic
911395323 1:97299508-97299530 ACTATTGTCCTGCAGATAAATGG - Intronic
911526134 1:98988717-98988739 ACTACTTTTCTCAAGATATTTGG + Intronic
914801635 1:150966712-150966734 ACTCCTGTTCTGAAGAAATCAGG - Intronic
915336696 1:155147569-155147591 GCCTCTGTACTGAAGATAAAAGG + Intergenic
917806001 1:178614331-178614353 ACCACTGTAATGAAGACATTTGG - Intergenic
918314278 1:183309980-183310002 AGTACTTTCCTGAAAATATAGGG + Intronic
918692030 1:187493000-187493022 ATTACTGTCCTAAATATATAAGG - Intergenic
918800956 1:188970777-188970799 ATTACTGAAATGTAGATATAGGG + Intergenic
921537640 1:216371149-216371171 ACTTGTGAACTGAAGTTATAAGG - Intronic
923283194 1:232464861-232464883 ACAACTGTGCTGAAGACATCAGG - Exonic
923731062 1:236550535-236550557 ACTGCTGTACAGAAGAGTTAAGG + Exonic
924445392 1:244125117-244125139 AGTACTGTACTGAAAATTTGGGG + Intergenic
1063020842 10:2126083-2126105 GCTACAGTAATGAAGATATGTGG + Intergenic
1068225416 10:54102031-54102053 AATACTGTTCTAAAGACATATGG + Intronic
1071188817 10:83077234-83077256 ACCACTATGCTGAAGAGATAAGG - Intergenic
1072290966 10:93964149-93964171 ATTACTATATTTAAGATATATGG + Intergenic
1074663266 10:115688691-115688713 ACTAATATACAGAATATATAAGG - Intronic
1074837263 10:117308921-117308943 ACCACTGGACTGAATATATGTGG + Intronic
1077290811 11:1791132-1791154 ACTGATGTACTGACGATATTAGG + Intergenic
1077698892 11:4421234-4421256 ACTACAGTACTGTAGCTATTTGG - Intergenic
1079732908 11:23958601-23958623 AATACTGAACTGAGGATAGACGG - Intergenic
1082740914 11:56909977-56909999 AATACTGTTTTGAATATATATGG - Intergenic
1084418130 11:69045807-69045829 GCTTCTGTTCTGAAGATATCAGG + Intergenic
1085841282 11:80014149-80014171 ACCACTGTATTGAAGACAGATGG - Intergenic
1086474855 11:87161626-87161648 ACTGCTGTAAGAAAGATATATGG - Intronic
1088371983 11:109100670-109100692 ACTACTGTGTTGGAGAAATAAGG - Intergenic
1097370424 12:58772128-58772150 ACTCCTGTACTTAAAATAAAAGG + Intronic
1101184956 12:102266246-102266268 ACATCTGTATTGAATATATATGG - Intergenic
1109473744 13:62848996-62849018 ACAGCTTTACTGAAGAAATATGG - Intergenic
1109488199 13:63056441-63056463 ATTACTGTGATGAAGCTATATGG - Intergenic
1110709699 13:78636710-78636732 ACTGCTTCTCTGAAGATATAAGG + Intronic
1111115456 13:83771269-83771291 ACTATTGTCCTAAAGATAAAAGG + Intergenic
1113183573 13:107660029-107660051 TCTACTTTACTGAAAATATTTGG - Intronic
1113189988 13:107734002-107734024 GCTACTGTACTGAATATGTTAGG + Intronic
1114298784 14:21355181-21355203 ACTATTGTAGTTAAGAAATAGGG + Intronic
1117709439 14:58509943-58509965 ACTTCTGTTCAGAATATATAAGG + Intronic
1117725783 14:58672289-58672311 ACACCTGCACTGAAGATATTAGG + Intergenic
1117888861 14:60396063-60396085 ACTACTGTAATGAAAATTTCTGG - Intergenic
1118408830 14:65454953-65454975 AATACTCTACTGAAGATTAATGG + Intronic
1118825782 14:69379726-69379748 ACTACTGTAGGGAAGCTATAAGG - Intergenic
1120686035 14:87538909-87538931 AGTTCTGTAGTGAAGGTATATGG + Intergenic
1126713548 15:51488059-51488081 ACAACTTTAATGAAGATAGATGG - Exonic
1139084567 16:63568903-63568925 ACTAGTTTACTGATGAAATATGG + Intergenic
1140675409 16:77324034-77324056 AATTCTGTGTTGAAGATATAAGG - Intronic
1140791510 16:78396165-78396187 ACTACTGTAAGAAAGAAATAAGG - Intronic
1145824208 17:27864661-27864683 GCATCTGTACTGAAGACATATGG + Intronic
1148086892 17:44999090-44999112 ACCACTACAATGAAGATATAGGG + Intergenic
1149691517 17:58580928-58580950 ACTGGTGTTCTGCAGATATACGG - Intronic
1150943376 17:69717805-69717827 AATACTGCACTGAAGATTAAAGG - Intergenic
1151056671 17:71039470-71039492 ACTAAAATACTGAAGATTTATGG - Intergenic
1156028716 18:32688246-32688268 ACTACAGGACTGAACAGATAGGG + Intronic
1157646362 18:49277210-49277232 AATACAGAACTGAACATATATGG + Intronic
1159329066 18:66965234-66965256 ACTACTGTTATGAACAAATATGG + Intergenic
1159619532 18:70621277-70621299 TCTACAGTAGTGAAGATGTAAGG - Intergenic
1163184213 19:15626115-15626137 ACTACAGAACTGAAGAGAAAAGG - Intronic
1164014549 19:21241898-21241920 AAACCTGTAATGAAGATATATGG + Intronic
1165578358 19:36840764-36840786 ACTACTGTCCTAAAGATGTATGG + Intronic
926288546 2:11510173-11510195 ACTAATTTACTGAATATACAGGG - Intergenic
928061943 2:28122655-28122677 ACTAATGTTCTCAACATATAGGG + Intronic
929001074 2:37347351-37347373 ACTAGTGAACTGAAGAGCTAGGG + Intronic
930550100 2:52822979-52823001 ACTACTATAATAAAGACATATGG - Intergenic
932052971 2:68417290-68417312 ATTACTGCAATCAAGATATATGG - Intergenic
936752928 2:115668085-115668107 ACTACTGTACTGAAGATATATGG - Intronic
936804412 2:116310505-116310527 GCTAATGTCCAGAAGATATAAGG - Intergenic
937655547 2:124371071-124371093 GCTACTGTCCTCCAGATATAAGG + Intronic
938547718 2:132350534-132350556 ACTTCTGCAAAGAAGATATAAGG - Intergenic
938883052 2:135611594-135611616 ACTACTGTACTGAAAATGTGGGG - Intronic
939439625 2:142229675-142229697 TCCACAGTAATGAAGATATATGG + Intergenic
940685275 2:156841498-156841520 ACTACTGTACTGTATATAGATGG - Intergenic
941234248 2:162949172-162949194 ACTTCTGAACTCATGATATAAGG + Intergenic
941943731 2:171071878-171071900 ACAACTTCACTGTAGATATATGG + Intronic
942062261 2:172238773-172238795 AGAACTTTACTGAAGATTTACGG - Intergenic
943627279 2:190214937-190214959 TCTACTGTTCAGAAGAAATAGGG - Intronic
944160522 2:196654707-196654729 CCTACTGAAATGGAGATATATGG - Intronic
944209919 2:197196640-197196662 ACTACTGTATACAAGATATATGG + Intronic
944976626 2:205060614-205060636 AATGCTGTACTCAAGATAGAAGG - Intronic
945423276 2:209665115-209665137 AATACTGTAGTGAAAGTATATGG + Intronic
945465540 2:210166110-210166132 ACTACTGTACTACAAATAAAAGG + Intronic
945586296 2:211668085-211668107 ATTACTGTACTGAATATTTTAGG + Intronic
947193290 2:227533934-227533956 ACTACAAAACTGAAGACATAGGG + Intronic
1169950975 20:11042735-11042757 ACCACTGTCCTAAAGAAATAAGG - Intergenic
1170177758 20:13491455-13491477 ACTCGTGTACTCAAGATACAGGG - Intronic
1170413380 20:16114331-16114353 AATACTATACAGAAGATACAGGG - Intergenic
1171094152 20:22315608-22315630 TCTACTTTACAGAAGATCTAAGG + Intergenic
1173176027 20:40765588-40765610 ACCACTGATCTGAAGATAAAGGG + Intergenic
1175466835 20:59194985-59195007 ATTACTGTACTCAAGACATGAGG + Intronic
1176054844 20:63139482-63139504 ACCACTATAGTCAAGATATAGGG - Intergenic
1181574521 22:23785303-23785325 ACCTCTGTACTGAACATGTACGG + Intergenic
953666196 3:44928106-44928128 ACTTCTCTACGTAAGATATACGG - Intronic
955976569 3:64485785-64485807 ACTACTGTTGTAAAAATATAAGG + Intergenic
960760239 3:121065185-121065207 ACTGCTGTACTAAACATATGAGG + Intronic
961031356 3:123607075-123607097 ACAACTGTACTAAAGATGGAAGG - Intergenic
962179476 3:133190696-133190718 GCTGCTTTACTGAAGAGATATGG - Intronic
963798564 3:149655868-149655890 GCTACTCTACTAAAGAAATATGG + Intronic
970693387 4:18645409-18645431 GCTTCTGTTCTCAAGATATAGGG + Intergenic
972030168 4:34445351-34445373 GCTACAGAACTGAAAATATAAGG - Intergenic
972161871 4:36237183-36237205 ACTACAGTACAGCTGATATAAGG + Intronic
973068653 4:45829931-45829953 AATAATATACTCAAGATATATGG - Intergenic
973254186 4:48092438-48092460 ACCACTGTACTGTCAATATAGGG + Intronic
974837171 4:67265084-67265106 TTTACTGAAATGAAGATATAAGG + Intergenic
976369426 4:84269873-84269895 ACTACTGCACTGAAGACATAGGG + Intergenic
978912068 4:114075856-114075878 ACTAATATACAGAATATATAGGG + Intergenic
979187803 4:117820275-117820297 ATTACTTTGCTGAAAATATATGG + Intergenic
979302473 4:119102590-119102612 ACTACTATACAGAAATTATATGG + Intergenic
981271726 4:142853574-142853596 AGAACTGAATTGAAGATATAGGG - Intergenic
983808235 4:172021784-172021806 ACGAGTTTACTGTAGATATATGG - Intronic
984106985 4:175559886-175559908 ACTATTGTACTAAAATTATAAGG + Intergenic
984611901 4:181850514-181850536 ACTACTGTACTATAGAAATATGG - Intergenic
987426946 5:17784319-17784341 ACAAATATACTGAAGATACATGG + Intergenic
988004152 5:25386281-25386303 ACTTCTCTAGTGAAGATATGAGG + Intergenic
988206947 5:28150094-28150116 AGTACAGTACTGTACATATAGGG - Intergenic
989699942 5:44251746-44251768 ACTATTGTTCTGAAGATATCTGG + Intergenic
991358669 5:65796842-65796864 ACCAATGTACTGAATACATATGG - Intronic
993013430 5:82509546-82509568 ACTCCTGTGCTGATGCTATAGGG + Intergenic
994431797 5:99675129-99675151 ACTACTATACTGTAGACATGAGG + Intergenic
995171190 5:109114557-109114579 AATACTGTACTGAATATTTTAGG + Intronic
995557373 5:113343622-113343644 AGTACTGTGGTGAACATATAAGG - Intronic
996666839 5:126069559-126069581 ACTTCTCTAAAGAAGATATATGG + Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999592691 5:153166225-153166247 ACTACTAACCTGAAGAAATATGG + Intergenic
1001363273 5:171109712-171109734 GCAACCGTACTGAACATATATGG - Intronic
1004705195 6:18118027-18118049 ACTACTGTACTGAATAACCATGG - Intergenic
1005690969 6:28305125-28305147 ACCATTGTACTGAACATCTATGG + Intergenic
1007840767 6:44714213-44714235 ACTATTGTAATGATGATATGTGG + Intergenic
1008266202 6:49429493-49429515 ACACCTGAACTGAAGAAATAGGG - Intergenic
1009475502 6:64085756-64085778 ACTGCTTTACTTAAGTTATATGG + Intronic
1009624156 6:66116224-66116246 ACAACTTTACTGAAGTTATGTGG - Intergenic
1010026093 6:71219034-71219056 ACTTCTGTACTTAAAATAGAGGG + Intergenic
1011390003 6:86841750-86841772 ACTACTGTACTGCTGATCTATGG + Intergenic
1017048857 6:150372032-150372054 ACTCCTTTACTGAAGACACATGG + Intronic
1021050952 7:15984130-15984152 ACTACTATACTCAAGATACCCGG - Intergenic
1021292405 7:18862941-18862963 ACTACTGTAATGAGGAGAAAAGG - Intronic
1021761831 7:23909877-23909899 ATTACTGTACTGAATAAGTAGGG + Intergenic
1023646400 7:42320868-42320890 ACTTCTCTTCTGAAGATTTAAGG + Intergenic
1024016614 7:45322100-45322122 ACAACTATACTGAATATAAATGG - Intergenic
1025010977 7:55398356-55398378 AATAATGTCCTGAAGATAAAAGG + Intronic
1026134441 7:67647031-67647053 AGAGCTGTACTGAACATATAAGG - Intergenic
1026167816 7:67926098-67926120 ACTACTGCAATTAAGATACATGG + Intergenic
1027892820 7:83998301-83998323 GCTACTGTACTGAATATTTTAGG + Intronic
1028388579 7:90288559-90288581 ATTACTGTACTGAAGATTGTAGG + Intronic
1030896852 7:115071288-115071310 ACTAATGAACAGAATATATAAGG + Intergenic
1031202406 7:118704464-118704486 ACTACTTTTCTGAAGACTTATGG + Intergenic
1034095326 7:148402493-148402515 ACTAAGATGCTGAAGATATAAGG - Intronic
1035981449 8:4376906-4376928 ACTACTGTACTGCAATTTTATGG + Intronic
1036024744 8:4893295-4893317 ATTACTCTACAGAATATATAAGG - Intronic
1038124822 8:24661606-24661628 ACTTTTGTACTGAGGACATATGG + Intergenic
1044240884 8:89887370-89887392 ACGACTTTACTGAAGATTTGAGG - Intergenic
1044835493 8:96291752-96291774 TCTACTTTATAGAAGATATAGGG - Intronic
1045612546 8:103862993-103863015 AGTACTGTATTGAATATAAATGG + Intronic
1051194651 9:14550055-14550077 ACTAATGTCCTTAAGATATAAGG - Intergenic
1051415322 9:16833666-16833688 ACTACTGCACTTAAGACAAATGG + Intronic
1052953146 9:34229972-34229994 AGTACTGTGCTAAAGATATGAGG - Intronic
1053346853 9:37384485-37384507 AAAACTGTACTTAAGAGATACGG - Intergenic
1057905660 9:98981146-98981168 AGTACTGTTGTGAAAATATAAGG + Intronic
1186161669 X:6783149-6783171 GCTTCTGTTCTCAAGATATAGGG - Intergenic
1188959843 X:36477859-36477881 ACTACTATATTGAAAATCTAGGG - Intergenic
1189667505 X:43372704-43372726 GCTACTGTACAGATGATAAAGGG - Intergenic
1189812784 X:44796504-44796526 ATTACTGTACTTCAGATGTATGG + Intergenic
1190367112 X:49705981-49706003 ATTTCTGTATTGAAGATAGAAGG + Intergenic
1190994200 X:55589527-55589549 ACTACTGTACTGAATATTATAGG - Intergenic
1192345976 X:70306234-70306256 GCTACAGTAATGAAGACATAAGG - Intronic
1194017306 X:88639215-88639237 ACTAAGGTACTGCAGAAATAAGG - Intergenic
1194537705 X:95126851-95126873 ACTAGTTTACTGTAGATGTACGG - Intergenic
1196238025 X:113305697-113305719 ATGACTGCACTGAAGAAATATGG - Intergenic
1197470480 X:126861998-126862020 ACTGCAGAACTGAACATATATGG + Intergenic