ID: 936758028

View in Genome Browser
Species Human (GRCh38)
Location 2:115737904-115737926
Sequence CTCTGCATAGAGGTAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936758028_936758032 2 Left 936758028 2:115737904-115737926 CCTTTCTCTACCTCTATGCAGAG 0: 1
1: 0
2: 0
3: 16
4: 244
Right 936758032 2:115737929-115737951 GTTCTAGTTCCCTAGGATAGCGG 0: 1
1: 0
2: 1
3: 12
4: 149
936758028_936758031 -5 Left 936758028 2:115737904-115737926 CCTTTCTCTACCTCTATGCAGAG 0: 1
1: 0
2: 0
3: 16
4: 244
Right 936758031 2:115737922-115737944 CAGAGGAGTTCTAGTTCCCTAGG 0: 1
1: 0
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936758028 Original CRISPR CTCTGCATAGAGGTAGAGAA AGG (reversed) Intronic
903258117 1:22116213-22116235 CTTTGCATAGTGCTAGAAAATGG + Intergenic
905111455 1:35597637-35597659 TTCTGCAGAAAGGAAGAGAAAGG + Intergenic
905268222 1:36769644-36769666 CGCTTCATAGAGGCAGAAAAGGG - Intergenic
906709505 1:47918737-47918759 GTCTGCATGGAGGCATAGAATGG - Intronic
907282446 1:53359934-53359956 CTGAGCAAAGAGGTAGAGGAGGG - Intergenic
907608101 1:55839891-55839913 CTCGGGATAAGGGTAGAGAAGGG - Intergenic
908358432 1:63344708-63344730 CTTTCCAGAGAGGTTGAGAAGGG + Intergenic
910326798 1:86018447-86018469 CTCTTTAAAGAGATAGAGAAAGG + Intronic
915435746 1:155904497-155904519 CTCTGCCTAGAGGGAAACAAGGG + Exonic
915930993 1:160060988-160061010 CTCTGCCTAGGGGTAGTGCAAGG + Intronic
916081933 1:161239025-161239047 CTCTGGAGACAGGGAGAGAATGG + Intergenic
916411062 1:164547610-164547632 CCCTTCATAGATGAAGAGAAAGG + Intergenic
918126406 1:181587971-181587993 CACTGCATAGAAGTAGGGAGTGG + Intronic
920100434 1:203513894-203513916 CCCTCCAGAAAGGTAGAGAAAGG + Intergenic
921805476 1:219449232-219449254 CTCTGAAAAGAAGCAGAGAATGG + Intergenic
924017995 1:239748821-239748843 CTCTGCATAAATCTAGAGAAGGG - Intronic
924536536 1:244940357-244940379 CTGTTCAGAGTGGTAGAGAATGG - Intergenic
1069908419 10:71745713-71745735 ATCTGCCCAGAGGCAGAGAAGGG - Intronic
1071219216 10:83444212-83444234 TTCTTCATAGAGGAAAAGAAGGG - Intergenic
1073058989 10:100722189-100722211 ATCTTCATAGAGGTAGGGACTGG + Intergenic
1075443649 10:122498929-122498951 CCCTGCATAGAGACAGGGAAGGG - Intronic
1076415567 10:130285300-130285322 CTCAGCATAGAGGCATACAAAGG - Intergenic
1077728681 11:4704496-4704518 CTTTGCATAGAGCCAGAGTAAGG - Intergenic
1077874513 11:6292610-6292632 CTCAGCAGAGAGGCAGAAAAGGG + Intergenic
1079104516 11:17561644-17561666 CTCAGCTGAGAGGTAGAAAAAGG - Exonic
1079535105 11:21504744-21504766 CTCTGCTTCGAGCTAGTGAATGG - Intronic
1081026363 11:38019615-38019637 CTCTGCATAGTGTTAGCGCAAGG - Intergenic
1082211757 11:49511839-49511861 CTTTACATAGGTGTAGAGAATGG + Intergenic
1083695707 11:64440845-64440867 CTGTGCATAGGGGTAGGGAGTGG + Intergenic
1086915308 11:92523337-92523359 CTCTGCATAGTGGTAGGCCATGG - Intronic
1087013977 11:93538590-93538612 CTCTGCTAACAGCTAGAGAAAGG - Intronic
1088340730 11:108763144-108763166 CACTTAATAGAGGCAGAGAAGGG + Intronic
1089077915 11:115753471-115753493 CTCTGCAGAGAATTAGATAAAGG - Intergenic
1089108079 11:116031842-116031864 CAATGAATAGAGGTAGAGAAGGG + Intergenic
1089418568 11:118314192-118314214 CTCTCCATAGGGGAAGGGAAAGG - Intronic
1090056664 11:123430321-123430343 CGCTGCAGGGAGGTAGAGAGCGG - Intergenic
1090436550 11:126691694-126691716 CTTTGGGTAGAGGAAGAGAAAGG + Intronic
1091501608 12:1023106-1023128 TTCTACATAGAGCTTGAGAATGG + Intronic
1091547561 12:1512441-1512463 CTCTGCTTAAAGGTATAGATTGG + Intergenic
1094141913 12:27190072-27190094 CTCTACATACATATAGAGAAAGG - Intergenic
1094245362 12:28285458-28285480 TTCTGCATGTAGGGAGAGAATGG - Intronic
1094689663 12:32756263-32756285 CTGTTCACAGAGGTTGAGAAAGG + Intergenic
1095972366 12:47911194-47911216 CTTTCCAGAGAGGAAGAGAATGG - Intronic
1096388899 12:51214297-51214319 ATGTACATAGAGGTAGAGAGAGG + Intronic
1097045377 12:56183931-56183953 CTGGGGATAGAGGAAGAGAAGGG + Intronic
1100731673 12:97477720-97477742 CTCTGCAATGAGGAAGAGAAAGG + Intergenic
1101838164 12:108309612-108309634 CTCTGCATGAAGGTAGTGACTGG - Intronic
1102744533 12:115238718-115238740 CTCCGCATAGAAGTTGAGGAGGG - Intergenic
1103518292 12:121521431-121521453 GCCTGCATGGAGGTGGAGAAAGG - Intronic
1103897899 12:124286101-124286123 CTCTGCAAAGAGCCTGAGAAAGG - Intronic
1104134141 12:125921483-125921505 CTCTGCACAGAGGATGAGACAGG - Intergenic
1104148512 12:126058771-126058793 CTCTGCATTGAGGCGGAGAAAGG + Intergenic
1105412367 13:20181436-20181458 CAATTCATAGAGGAAGAGAATGG - Intergenic
1106485011 13:30164393-30164415 GTCTGCTTAGAGAGAGAGAATGG + Intergenic
1106615827 13:31326608-31326630 ATCTGCATACAGGAAGAGAGAGG - Intronic
1106731135 13:32542687-32542709 CAATGCATAGGGGTAGAGTAAGG - Intergenic
1107655126 13:42585075-42585097 ATCTGAATAGAGTAAGAGAAGGG - Intronic
1109944692 13:69418574-69418596 CTCTGGATAGAGATATTGAATGG + Intergenic
1111021895 13:82460650-82460672 CTCTGGATGATGGTAGAGAAAGG + Intergenic
1112958904 13:105097240-105097262 CTATGAATGTAGGTAGAGAAGGG + Intergenic
1114424354 14:22609962-22609984 CTCAGCCTTGGGGTAGAGAAGGG + Intronic
1115098940 14:29674611-29674633 CCCTGAATAGAGGGAAAGAAAGG + Intronic
1115167490 14:30465213-30465235 CAGTGCAAAAAGGTAGAGAAAGG - Intergenic
1117484002 14:56175415-56175437 CTCTGCTCAGAAGGAGAGAAAGG - Intronic
1118435960 14:65771087-65771109 CTTTTCAAGGAGGTAGAGAAAGG - Intergenic
1118757306 14:68854194-68854216 TGCAGCATAGAGGAAGAGAAAGG - Intergenic
1120174675 14:81280428-81280450 TCCTGCAGAGACGTAGAGAATGG - Intronic
1124552574 15:30695161-30695183 CCCTGCATAGAGGTGCAGAGGGG - Intronic
1127192625 15:56547645-56547667 CACTGGATACAGGTAGTGAAAGG + Intergenic
1127207674 15:56737326-56737348 CTCTGCTTTTAGGTAGATAAGGG - Intronic
1128159108 15:65411369-65411391 CCCTGCATAGAGGAGGAGCACGG + Exonic
1130941451 15:88513003-88513025 CTCTGCACAGAAATAGCGAAAGG + Exonic
1131554145 15:93382324-93382346 CTCAGCATATTGGCAGAGAAAGG - Intergenic
1131613414 15:93988619-93988641 CACTGGAAAAAGGTAGAGAATGG + Intergenic
1133133536 16:3693257-3693279 ATCTGCATAGAGATAAAGACAGG - Intronic
1135980371 16:27142418-27142440 CTCTGGTTAGAGCCAGAGAAAGG - Intergenic
1136110383 16:28061024-28061046 CACTCCACAGAGGTAGAGACAGG + Intronic
1137810277 16:51346000-51346022 TTTTCCATAGAGGAAGAGAATGG + Intergenic
1138661746 16:58523405-58523427 CTCTGCAAAAAGGTACAGCATGG + Exonic
1139306281 16:65988889-65988911 CTCTGCGTTGGGGTAGAGATAGG - Intergenic
1139427866 16:66894374-66894396 ATCAGCATAGAGGTAGGGAGGGG + Intronic
1140881568 16:79202822-79202844 GTCTACATAGGGGAAGAGAAAGG + Intronic
1140911046 16:79453194-79453216 CTCAGAATAGAGGCAGATAAAGG - Intergenic
1142843267 17:2650780-2650802 CACTTCACAGAGGAAGAGAATGG - Intronic
1143162096 17:4878564-4878586 CTCTGCACTCAGGTAGAGAGAGG - Intronic
1144845981 17:18219316-18219338 CTCTGCAGAGGGAAAGAGAAAGG - Intergenic
1146455254 17:33004665-33004687 CTGTACCTACAGGTAGAGAAGGG - Intergenic
1147510268 17:41062578-41062600 AACTGCAAAGAGGTGGAGAAAGG - Intergenic
1153784884 18:8525915-8525937 TTCTGCACACAGGGAGAGAAGGG - Intergenic
1153953502 18:10076465-10076487 CTCTGCCTAGACCTAGAGACTGG - Intergenic
1154109476 18:11553486-11553508 TTCTGGATAGAGGGAGATAATGG + Intergenic
1156307983 18:35896894-35896916 CAGTGCACAGAGGTAGGGAATGG + Intergenic
1156376169 18:36517038-36517060 GTCTGCTGAGAGGTAGAGATAGG + Intronic
1157538897 18:48484979-48485001 CTCTTCAGAGAGGCAAAGAATGG - Intergenic
1157605961 18:48926140-48926162 CTCTGCCTTCAGGTGGAGAATGG - Intronic
1157916181 18:51665767-51665789 CTCTGCATCAAGCTAGAAAAAGG + Intergenic
1157970806 18:52266433-52266455 ATCTACCTAGAGGAAGAGAAGGG + Intergenic
1161322025 19:3645776-3645798 CTCTGCACAGCGGTAGAGCACGG - Intronic
1164082951 19:21876301-21876323 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1164190931 19:22916418-22916440 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1166509488 19:43395264-43395286 CTCTGCTTTTAGGTAGATAAGGG + Intergenic
1167767283 19:51491828-51491850 CCCTGAATGGAGGAAGAGAAGGG + Exonic
1167774999 19:51548961-51548983 CTCCGCATGGTGGTAGAAAATGG - Intergenic
1168697904 19:58415861-58415883 CTCTGCACAGATACAGAGAAGGG - Intronic
925815294 2:7741633-7741655 TTTGGCAAAGAGGTAGAGAAAGG - Intergenic
925844915 2:8026466-8026488 CTCTGCATGCAGGGTGAGAATGG + Intergenic
930307745 2:49697218-49697240 CTCTACATAGAGGAATGGAATGG + Intergenic
932593687 2:73081418-73081440 CTCTGCAAAGAGGTGAGGAACGG + Intronic
932854927 2:75223154-75223176 CTTTGCAAAGTGGAAGAGAAAGG + Intergenic
933985188 2:87584748-87584770 CTCTGCCTACAGTTAGAGGAAGG - Intergenic
935639862 2:105280471-105280493 CTCTGCATACAGTTTGAGCAAGG + Exonic
936343023 2:111654239-111654261 GTCTGCATTGAGGTATAGCACGG + Intergenic
936758028 2:115737904-115737926 CTCTGCATAGAGGTAGAGAAAGG - Intronic
937003051 2:118485803-118485825 CTCTGCATAGAAGAAAAGACGGG + Intergenic
937259419 2:120576144-120576166 CTCTGCAGAGACACAGAGAAGGG + Intergenic
937499941 2:122467377-122467399 CTCTGGACACAGGTAGGGAAAGG + Intergenic
937620006 2:123974374-123974396 GTCAGCATATTGGTAGAGAATGG - Intergenic
938394298 2:130931070-130931092 CTCTGCAGAGATGCAGAGGAGGG - Exonic
942549459 2:177099731-177099753 TTCTGCATACAGTTAGAGCAAGG + Intergenic
944312913 2:198254699-198254721 ATCAGCATGGATGTAGAGAAGGG + Intronic
944801165 2:203239115-203239137 CACCGGATAGAGGTAGAGCACGG - Exonic
945155121 2:206830096-206830118 GTCTGCAAAGAGGCTGAGAAGGG + Intergenic
945995372 2:216431932-216431954 GTATGCATAAAGGCAGAGAAAGG - Intronic
948724502 2:239924526-239924548 CTCGGCAAACAGGTAGAGAGAGG + Intronic
1169317815 20:4607985-4608007 CTATGGAAAGAAGTAGAGAATGG - Intergenic
1170198093 20:13711688-13711710 CTTTGCTTAGAGGCAAAGAAAGG - Intergenic
1170487034 20:16828824-16828846 CTCTGCATAGGGGAAGGGAAAGG + Intergenic
1170758912 20:19231778-19231800 CTCTGCAGAGAGTTAGACCATGG - Intronic
1172324691 20:34025248-34025270 CTCAGGAGAGAGGAAGAGAAAGG - Intronic
1176684855 21:9838553-9838575 CCCTGCAAAGAGGAAGAGAGGGG + Intergenic
1179639745 21:42739321-42739343 CTCTGGATTGAGGTGGAGCAGGG + Intronic
1180135137 21:45857591-45857613 CTCTGCTTTGAGGTCCAGAAAGG - Intronic
1180756072 22:18162147-18162169 CTCTACTGAGAGGCAGAGAAAGG - Intronic
1181075695 22:20375256-20375278 CTCTACTGAGAGGCAGAGAAAGG + Intronic
1181367679 22:22391232-22391254 CACTGCACAGAGGGAGAGACAGG - Intergenic
1182236717 22:28882692-28882714 CTGTGCATAGAGGGTGATAATGG + Intergenic
1183227042 22:36557539-36557561 CTCTCAATAGAGGCAGAGACAGG - Intergenic
1183280307 22:36928762-36928784 CTCAGCCTGGAGGTAGGGAAGGG + Intronic
1185130235 22:49034883-49034905 CTGTGCATAGAGGAACAGGATGG + Intergenic
949347843 3:3093662-3093684 CTCTGCAGAGAGGAATTGAACGG - Intronic
949420014 3:3855743-3855765 CTTTTCATGGAGGAAGAGAAAGG - Intronic
950168240 3:10817299-10817321 CTCTGCATAGAGATGTAGAAGGG + Intronic
950798554 3:15531134-15531156 CTATGGATAGAGGTTGACAAAGG + Intergenic
950874228 3:16255583-16255605 CTCTGCAAGTATGTAGAGAAAGG + Intergenic
952329942 3:32355601-32355623 CTCTGGCTGCAGGTAGAGAATGG - Intronic
952756355 3:36871417-36871439 CACTGGTTAGTGGTAGAGAATGG - Intronic
954522587 3:51242675-51242697 CTCTGCACAGTGTTAGAGCAAGG + Intronic
955631565 3:60980970-60980992 CTCAGCAGAGAGGAAGAGCAGGG - Intronic
955740520 3:62086332-62086354 CTCTGGAGAGAGAGAGAGAAGGG + Intronic
955817460 3:62860650-62860672 CTGGGCATAGGAGTAGAGAAAGG - Intronic
956172452 3:66443500-66443522 CTCTGTGTAGGGGAAGAGAAAGG + Intronic
956280354 3:67549811-67549833 CTCTGATTACTGGTAGAGAAAGG + Intronic
957162775 3:76631657-76631679 TTTTGCATAGAGTTAGAGCATGG + Intronic
958103293 3:89041701-89041723 CTGTGGCTAGGGGTAGAGAAGGG + Intergenic
958962574 3:100523908-100523930 AACTGCATAGAGCTAGAGAGCGG + Intronic
962430071 3:135311005-135311027 CTCTTCAGAGATGTGGAGAAGGG - Intergenic
962495405 3:135934869-135934891 TTCTGCATAGAGGAAGGGTAGGG - Intergenic
964089572 3:152858290-152858312 ATATGCATAGAGGGAGAGCAGGG + Intergenic
966900107 3:184476436-184476458 TTCTTCATAGAGGAAAAGAAGGG - Intronic
966903781 3:184507448-184507470 CTCTGCAGAGAGGGACAGAAGGG + Intronic
967833475 3:193942043-193942065 ATCTGCCTAGAGGTAGGCAAAGG + Intergenic
967842869 3:194020880-194020902 AACTGCATACAGGCAGAGAATGG - Intergenic
968159090 3:196410459-196410481 CTCTGCAGCAAGGTAGAAAATGG - Intronic
970130014 4:12858041-12858063 CCAAGGATAGAGGTAGAGAAAGG + Intergenic
970404625 4:15750464-15750486 CTCTGCTTAGAACTAGAGAGAGG + Intergenic
971590995 4:28469147-28469169 TTCTCCAGAGAGGCAGAGAAAGG - Intergenic
971725927 4:30312113-30312135 CTGAGCATAGAGGTAGAAAATGG - Intergenic
971738772 4:30493208-30493230 ATCTGGAGAGAGGGAGAGAAGGG - Intergenic
972924902 4:43991788-43991810 CTCGGATTAGAGGAAGAGAATGG + Intergenic
978281716 4:107024691-107024713 CTTTGCAAAGAGATGGAGAAAGG + Intronic
978444507 4:108767739-108767761 CTCTGCTTTTAGGTAGATAAGGG - Intergenic
978501477 4:109414654-109414676 CTCTGGATGGAGGTGGGGAAGGG + Intergenic
980255000 4:130368223-130368245 CTCTGTATAAAGAGAGAGAATGG + Intergenic
981191861 4:141873404-141873426 CTCTGCATGGCTGGAGAGAAAGG + Intergenic
982845818 4:160251046-160251068 GGCTGAATAGAGGAAGAGAAAGG - Intergenic
983168583 4:164510005-164510027 CTCTGAAAAGAATTAGAGAATGG + Intergenic
983755152 4:171326086-171326108 CACTGCATAGAGGTAGAAACAGG - Intergenic
985138211 4:186811371-186811393 ATCTGCCAAGAGGTAGAGGAAGG + Intergenic
986026247 5:3854215-3854237 CTCGGCATAGGGGGAAAGAAAGG + Intergenic
987316598 5:16730329-16730351 CTCTGCCTGGAGAGAGAGAAGGG + Intronic
987669639 5:20990371-20990393 TTCTGCCTGGAGGTAGAGTAGGG - Intergenic
988313164 5:29588086-29588108 TTCTCAATAGAGATAGAGAAAGG + Intergenic
990741912 5:58920871-58920893 CTGTGCATGCAGGTAGAGACTGG + Intergenic
992037806 5:72798259-72798281 CTCTCCATAAAGCTCGAGAAGGG + Intergenic
993680543 5:90872760-90872782 CTCTGTAAAGGGGTGGAGAAGGG - Intronic
994332590 5:98524741-98524763 CTCTATATAGTGGTAGTGAAAGG - Intergenic
994910142 5:105894419-105894441 CTCTGAATAGGGTTAGTGAAGGG + Intergenic
996106554 5:119511155-119511177 TTCTGCCTAGAGGGAGAGGAAGG + Intronic
996709136 5:126526583-126526605 CTCTGCTTTTAGGTAGAAAAGGG + Intergenic
997723286 5:136098134-136098156 CTCTGAATGGAGGTAGAAACTGG - Intergenic
998503973 5:142657363-142657385 CTGTGCAGAGAAGCAGAGAACGG - Intronic
998629603 5:143883447-143883469 CTTTGTTTAGAGGTAGGGAAGGG + Intergenic
1000891427 5:166807059-166807081 CTCTCCAGGGAGGTAGAAAATGG - Intergenic
1002108665 5:176893227-176893249 CTCTGCATTCAGGTAGATATGGG - Intronic
1003321270 6:5054157-5054179 CTCTGCAGGGAGGAAGAAAAGGG + Intergenic
1003334716 6:5159586-5159608 CTCTGGAGAGAGGTTGAGATGGG - Intronic
1004252252 6:14032436-14032458 CTCTACCTAGAGGAAGAGCAGGG + Intergenic
1005215518 6:23523093-23523115 CACAGCACAGAGGGAGAGAAAGG + Intergenic
1005388867 6:25313251-25313273 TTTTGCCTAGAGGGAGAGAAGGG + Intronic
1006680091 6:35790795-35790817 CTCTGCATTTAGGCAGACAAAGG + Intronic
1008975181 6:57417799-57417821 CCCTGCATTGAGATAGACAATGG - Intronic
1009164066 6:60319318-60319340 CCCTGCATTGAGATAGACAATGG - Intergenic
1010121666 6:72382829-72382851 CTCTGTGTAGAGGTAGAGGACGG - Intronic
1011939468 6:92825278-92825300 TTTTCCATAGAGGTGGAGAAGGG + Intergenic
1014908649 6:127062078-127062100 GTGTGCATGGTGGTAGAGAATGG - Intergenic
1015241649 6:131030742-131030764 CTCTGCCTAGAGGTACCAAAGGG + Intronic
1015449746 6:133351805-133351827 ATGTGTACAGAGGTAGAGAAAGG + Intronic
1015512569 6:134052833-134052855 CTTTGAAAAGAGGCAGAGAAAGG + Intergenic
1015897414 6:138030722-138030744 CTCTGCCTTGAGTTACAGAATGG + Intergenic
1018350420 6:162952751-162952773 GTCTGGGAAGAGGTAGAGAATGG + Intronic
1025928020 7:65974600-65974622 CTCTGCATAGGGGTAGTGGCTGG + Exonic
1026622316 7:71960743-71960765 ACCTGCATGGAGGTAGAGAGTGG - Intronic
1027245474 7:76364286-76364308 CCCTGCAGGGAGGAAGAGAAAGG - Intergenic
1028580691 7:92407016-92407038 CTATGCCTAGAGCTAGATAAGGG + Intergenic
1029440321 7:100583680-100583702 CTGGGCAGAGAGGAAGAGAAAGG - Intronic
1029490315 7:100867068-100867090 CTCTGCAGAGGGGTGGAGATCGG + Intergenic
1031881667 7:127205601-127205623 CTCTGCAGAGCGGTAGAGAGTGG - Intronic
1032464634 7:132136313-132136335 CTGTGCATTGAGGAAGGGAAAGG + Intronic
1032513312 7:132489108-132489130 CTCAGCACAGAGGCAGAGAAAGG + Intronic
1033298861 7:140167697-140167719 CTTTACCTTGAGGTAGAGAAAGG + Intronic
1033728390 7:144146921-144146943 CTCTGCATAGAGGAAAAAGAGGG + Intergenic
1034118524 7:148606148-148606170 CTCTGCAGATAGGTAGGGACAGG + Intronic
1034335991 7:150323710-150323732 CTCGGCACAGAGGGAGAGATGGG - Intronic
1036115767 8:5959300-5959322 TTCTGTAAAGAGGCAGAGAACGG - Intergenic
1038884386 8:31647496-31647518 CTCTGTACAGAGGTACAGACGGG - Intronic
1039451460 8:37677999-37678021 CAAGGCATAGAGGCAGAGAAGGG - Intergenic
1039807437 8:41012637-41012659 GTCTGCATAGAGGCAGAGGCTGG - Intergenic
1040131989 8:43807846-43807868 CTCTCCCTAGAGGTATCGAACGG - Intergenic
1040960265 8:53024554-53024576 CACTGCATAGCTGTAAAGAAGGG - Intergenic
1042821776 8:72937302-72937324 CTCTGGATAGAGTTAGAAACGGG - Exonic
1046069113 8:109229158-109229180 CTCAGTGTAGAGTTAGAGAAAGG - Intergenic
1046094256 8:109539409-109539431 CTCTGCATAGAAGGAAAGTAGGG + Intergenic
1046857146 8:119045320-119045342 CTCTGCATATAGGTGTGGAATGG + Intronic
1046933161 8:119861516-119861538 CTCTCCTTAGAGGTAAAGCATGG - Intergenic
1047457563 8:125029945-125029967 CTCTGCTTGGAGCAAGAGAAAGG + Intronic
1049662107 8:143824167-143824189 GTCTGCCCAGAGGCAGAGAAGGG + Intronic
1051860109 9:21615132-21615154 CCCTGTATAGAGGAAGAGGAGGG + Intergenic
1052206373 9:25846175-25846197 GTTTGCATACAGGGAGAGAAGGG - Intergenic
1054734943 9:68741663-68741685 CTAAGCAAAGAGATAGAGAAGGG + Intronic
1055243599 9:74215609-74215631 CTTAACAAAGAGGTAGAGAAGGG - Intergenic
1055546062 9:77374676-77374698 ACCTGCATAAAGGAAGAGAAAGG - Intronic
1056028300 9:82524330-82524352 CACCACATAGAGGTAGAGAAAGG + Intergenic
1056251400 9:84751975-84751997 CACAGCATAGACCTAGAGAAAGG - Exonic
1056576791 9:87860506-87860528 CTCTGCAAAGATGTAGGGCAGGG + Intergenic
1057906192 9:98985544-98985566 CTCTGCAGGGAGGGAGAGAGAGG - Exonic
1058000866 9:99863599-99863621 TTCTGCAGAGGGATAGAGAAGGG - Exonic
1060053353 9:120392581-120392603 CTCTGCATAGGTCTAGAGAAAGG - Intronic
1060261045 9:122073804-122073826 GTCAGCCTGGAGGTAGAGAAAGG - Intronic
1060590616 9:124814102-124814124 CTCTGCGGTGGGGTAGAGAATGG + Exonic
1061266031 9:129505582-129505604 CTCAGCAGAGAGGCAGTGAATGG - Intergenic
1186233005 X:7476346-7476368 CTCTTAATAGGTGTAGAGAAAGG + Intergenic
1186943711 X:14541226-14541248 CTCTGCATAGACCTTGAGAAAGG + Intronic
1190910845 X:54770836-54770858 TTCTACATAGAGGAAGAAAATGG - Intronic
1193027755 X:76863088-76863110 CTCTGCTTGGAGGTAGGAAATGG - Intergenic
1193694442 X:84690586-84690608 CTCTCCATAGAGGATGAGGAAGG - Intergenic
1193929815 X:87539803-87539825 CTCTTCATAGATGGAGATAAGGG - Intronic
1195511828 X:105724468-105724490 CTCTGCTTAAAGGGAGATAAAGG - Intronic
1197045739 X:121995965-121995987 CTCTCCATAGAGCCAAAGAAAGG - Intergenic
1197334985 X:125202822-125202844 CTTTGCCTAGAGGCGGAGAAGGG - Intergenic
1200694572 Y:6347570-6347592 TGCTGGATAGAGGTAAAGAAGGG + Intergenic
1201040705 Y:9827140-9827162 TGCTGGATAGAGGTAAAGAAGGG - Intergenic