ID: 936759021

View in Genome Browser
Species Human (GRCh38)
Location 2:115751492-115751514
Sequence AAGCAGAGCTCAGCTAGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936759021 Original CRISPR AAGCAGAGCTCAGCTAGTTG TGG Intronic
901426435 1:9184495-9184517 AAGCAGACCTCGGCCAGGTGTGG - Intergenic
902517990 1:17000157-17000179 GAGAGGAGCTCAGCTAGGTGGGG + Intronic
902665359 1:17933960-17933982 AAGCAGAGCTCAGCTCAGGGAGG + Intergenic
903420629 1:23216278-23216300 AACCAGAGCTCAGCCACTAGTGG - Intergenic
904074303 1:27828722-27828744 AGGCACTGCTCAGCAAGTTGAGG - Intergenic
904360882 1:29971112-29971134 AAGGAGAGCCCAGGAAGTTGGGG - Intergenic
905170514 1:36107111-36107133 AACCTGAGCTCAGCTGGGTGCGG + Intronic
906417308 1:45630472-45630494 AAGCAGAGCACAGGTAAGTGAGG - Exonic
912218170 1:107640769-107640791 AACCAAAGCTAAGCTTGTTGGGG - Intronic
912488942 1:110050643-110050665 ATCCAGAGCTCACCTAGTAGAGG + Intronic
914230214 1:145759175-145759197 TAGCAGAGCTCAGAGAATTGAGG - Intronic
916732442 1:167578809-167578831 AAGAAGAGCTCAGCTGGGCGCGG - Intergenic
917481521 1:175415858-175415880 AAGGTGAGGTCAGCTAGTTTGGG + Intronic
919261593 1:195202513-195202535 AAGCAGAGATCAGCAAACTGCGG - Intergenic
921001806 1:211051630-211051652 AAGGGGAGTGCAGCTAGTTGAGG + Intronic
923455603 1:234162571-234162593 GAGCAGAGGTGAGCTAGGTGAGG - Intronic
1063890103 10:10620240-10620262 CAGCAGAGTTCAGCCAGGTGTGG + Intergenic
1065224419 10:23528350-23528372 AGGCAGGGCCCAGGTAGTTGTGG + Intergenic
1066336110 10:34480138-34480160 GAGCAGAGCACAGATAGGTGTGG + Intronic
1066562752 10:36688646-36688668 AAGCAGATCTCAGCTGCCTGTGG - Intergenic
1067044129 10:42974997-42975019 ATGCAGAGCTCAGCAAGGAGGGG - Intergenic
1068142118 10:53022416-53022438 AAGCAGAGATAAGCTAGTCATGG + Intergenic
1069958449 10:72065902-72065924 AAGCAGAACTCAGAAAGATGTGG + Intronic
1074119562 10:110483614-110483636 AAGCAGAGATGAGCTGGGTGTGG - Intergenic
1074522819 10:114240203-114240225 AAGCAGGGCTGAGCCAGGTGGGG - Intronic
1076916066 10:133423646-133423668 TAGCAGAGCCCAGCACGTTGCGG + Exonic
1079026212 11:16950000-16950022 AAGCAGATCTCAGAGAGTGGAGG + Intronic
1080553082 11:33390879-33390901 CATCAGAGCTGAGCCAGTTGAGG - Intergenic
1083754821 11:64786323-64786345 AAGTAAAGCTCAGCGAGCTGGGG + Intergenic
1085206468 11:74736093-74736115 AAGCTGAGTTCAGCCAGTGGTGG + Intergenic
1085339025 11:75719348-75719370 AATCAGAGCTCAGCAGGTTTGGG + Intronic
1088329806 11:108639598-108639620 AACCAGAGCTCAGAGAGTAGGGG + Intergenic
1089073914 11:115721753-115721775 AAGCAGAGCTCCCCTTGCTGGGG + Intergenic
1089661876 11:119991245-119991267 AAGCAGAGCACACCTGGATGGGG - Intergenic
1091116617 11:133019328-133019350 AACCAGAGATAAGATAGTTGAGG + Intronic
1091940258 12:4473102-4473124 AGACAGAGCTGAGCTAGTGGGGG + Intergenic
1092212207 12:6653944-6653966 CACCAGAGCTCAGGAAGTTGAGG - Intronic
1092297331 12:7210780-7210802 AATCAGAGCTCAGCCAGGAGAGG - Intronic
1096504133 12:52082095-52082117 AAGCTGAGCCCAGCTGGCTGAGG - Intergenic
1096513110 12:52142767-52142789 AAGCAGAGCACAGCCAGTGCAGG + Intergenic
1097043830 12:56172692-56172714 AAGCAGAGGTCTGCTATTTGTGG + Exonic
1097836881 12:64282249-64282271 AAGCAGAGCTCAGCAAACTATGG + Intronic
1098460483 12:70727968-70727990 ATGCAGAGCTCAGCTCATTGAGG + Intronic
1098460517 12:70728243-70728265 ATACAGAGCTCAGCTCATTGAGG + Intronic
1103330173 12:120148767-120148789 AAGTAGAGCTGCTCTAGTTGGGG - Intronic
1104190628 12:126479230-126479252 AGGCAGGGCTCAGCTTGCTGGGG + Intergenic
1105652885 13:22399891-22399913 AAGCAGAGCTCAGCAAGAGATGG - Intergenic
1108088379 13:46819164-46819186 AAGAAGAGCTCAGAGAGATGAGG + Intergenic
1108430473 13:50348180-50348202 AAGAAGAGCTAAGCTAGTATGGG + Intronic
1109995240 13:70114955-70114977 AAGCAGAGCTCACACAGCTGAGG - Intergenic
1111692076 13:91577303-91577325 AAGCTGAGCTCAGCTAGCTAAGG + Intronic
1113544033 13:111132414-111132436 CAGCAGAGAGCAGCTAGTTTTGG - Intronic
1113602236 13:111578125-111578147 AGGGAAAGCTCAGCTAGGTGAGG + Intergenic
1119175883 14:72567464-72567486 AAGCAGAGCCCTGCTCGTGGCGG - Intergenic
1119959188 14:78835224-78835246 CAGCAGAGCTGAGCTATTTTTGG - Intronic
1121700884 14:95953245-95953267 AAGAAGAGATCAGCTGATTGGGG + Intergenic
1121782039 14:96628164-96628186 AACCAAAGCTCAGAGAGTTGGGG + Intergenic
1125300920 15:38252733-38252755 AAGCAGAGCTCCGCTCGGTGGGG - Exonic
1126723017 15:51602072-51602094 AAGCACAGAACAGCTATTTGAGG + Intronic
1127385424 15:58462846-58462868 CAGCAGAGCTCAGCTGGTCTTGG - Intronic
1132513283 16:354259-354281 AAGCAGAGGGCAGATAGATGAGG - Intergenic
1133227280 16:4347659-4347681 GAGCAGAGCTCTGCCAGCTGTGG + Intronic
1134668991 16:16040776-16040798 AACCAGAACTCAGCTGGGTGTGG - Intronic
1135148318 16:19983114-19983136 AAGCATAGTTGAGCTAGGTGAGG + Intergenic
1135913570 16:26582955-26582977 ACACAGAGCCCAGCTAGGTGTGG + Intergenic
1137607891 16:49798996-49799018 CAGCAGAGCTCATCTAGCTATGG + Intronic
1137946161 16:52734992-52735014 AAGCAGATCTTAGCTTGTGGTGG - Intergenic
1140811463 16:78582887-78582909 AACCAGAGCTCTGCTAATTTTGG + Intronic
1143030701 17:3965345-3965367 AGGCAGAGCCCAGCTCGTGGTGG - Intergenic
1143785540 17:9252836-9252858 AAACAGAGCACAGCTAGATTTGG - Intronic
1144828047 17:18117519-18117541 AACCAGAGTTCAGTGAGTTGAGG + Intronic
1154004251 18:10513199-10513221 AAGCAGTGCTCATCTGGCTGTGG - Intergenic
1155263946 18:24073348-24073370 AATCTCAGCTCAGCTAGATGAGG - Intronic
1157114248 18:44848239-44848261 AAGCAAGGCTTAGCTAGTTTGGG + Intronic
1161483932 19:4524816-4524838 GTGCTGAGCTCAGCTAGTTGAGG - Intronic
1161874121 19:6894402-6894424 AAGAAGAGCTCAGGGAGCTGTGG + Intronic
1162037722 19:7951226-7951248 AAGCAGAGATCAGCCGGGTGCGG + Intergenic
1163248820 19:16113688-16113710 AAGCACAGCTCCGCTGGGTGCGG - Intronic
1163556780 19:17997768-17997790 ATGCCAAGCTCAGCTGGTTGTGG - Intronic
1167580348 19:50337588-50337610 CAGCAGAGCTCCCCAAGTTGGGG - Intronic
1167583911 19:50362226-50362248 CAGCAGAGCTCCCCAAGTTGGGG - Exonic
927184883 2:20474967-20474989 AAGCAGAGATCTGCAAGCTGGGG + Intergenic
930869411 2:56154626-56154648 AATGAGAACTCAGCTAGCTGTGG - Intergenic
932059077 2:68477341-68477363 AAACAGATCTCAGCTGGGTGTGG + Intronic
932199284 2:69811493-69811515 AAGCAGGACTGAGCTAGGTGGGG + Intronic
932322936 2:70835155-70835177 GAGCAGAGCTCAGATTGGTGGGG + Intronic
932410632 2:71545333-71545355 AGGCAGAGAGCAGCTAGATGTGG - Intronic
932607065 2:73172470-73172492 AGGCTGAGCTCAGATGGTTGGGG - Intergenic
933760330 2:85668058-85668080 AAGCAGTGCTCAGTGAGTGGTGG + Intronic
933925365 2:87087941-87087963 AGGCTGAGCTCAGATGGTTGGGG + Intergenic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
936759021 2:115751492-115751514 AAGCAGAGCTCAGCTAGTTGTGG + Intronic
938677944 2:133657825-133657847 AGTCAGAGCTCAGCTATTTGGGG + Intergenic
945832239 2:214801792-214801814 AAGAAGAGAGCATCTAGTTGGGG + Intronic
947581673 2:231323513-231323535 AAACTGAGCTGCGCTAGTTGAGG - Intronic
948701185 2:239761451-239761473 TAGCAGAGGTCAGGTATTTGTGG + Intergenic
1168849442 20:966570-966592 AATCAGTGCTCAGCCAGGTGTGG + Intronic
1169314893 20:4582260-4582282 AAGCAGAGCTTAGATAGTTTGGG - Intergenic
1171414001 20:24965324-24965346 CAGCAGGGCTCAGCTGGCTGTGG - Intronic
1172647952 20:36483322-36483344 AGGCAGAGCTCAGCTACGGGAGG + Intronic
1173516730 20:43669586-43669608 AAGCAGAGTCCAGTTAGTGGTGG - Intronic
1175963511 20:62648661-62648683 CAGGAGAGCTCAGCTGGTTCAGG + Intronic
1178933623 21:36841760-36841782 GAACAGAGCCCAGCCAGTTGAGG - Intronic
1179049099 21:37873525-37873547 TAGCAATGCTCAGCTAGTTGTGG - Intronic
1181998398 22:26901428-26901450 CAGAAGAGCTCAGCTACTTTAGG + Intergenic
1183214288 22:36469081-36469103 AAGCAGAGCTCAGGTTCTGGCGG + Intronic
1183782341 22:40006919-40006941 GGGCAGAGCTCAGCCAGCTGGGG + Intronic
950288639 3:11765310-11765332 AGTAAGAGCTCAGCTAGTGGTGG - Intergenic
950439590 3:13001558-13001580 GAGCAGAGCTCAGTTGGTAGAGG + Intronic
950815009 3:15691836-15691858 AAGAAGAGTTTAGCCAGTTGTGG + Intronic
951391183 3:22106121-22106143 AAGCAGAGCCCAGGTATTTGTGG + Intronic
951615731 3:24541391-24541413 AACCAGAGGTCAGCAAATTGTGG - Intergenic
953345415 3:42171591-42171613 GAGCAGAGCTCAGGGAGTGGTGG - Intronic
953925784 3:46981832-46981854 GTACAGAGCTCAGCTAGATGGGG - Intronic
954560176 3:51549915-51549937 AACCAGAGCCAAGCTAGTAGGGG - Intronic
954944506 3:54408196-54408218 AAGGAGACCTCACCTAGTTTGGG + Intronic
955067843 3:55547871-55547893 CAGCAGAGCTGGACTAGTTGGGG + Intronic
960048519 3:113219602-113219624 AAGCAGAGCTCTTCTAGCTTCGG + Intronic
960452974 3:117832780-117832802 TAGCAGAGTTCAGCTTGTTCAGG + Intergenic
961956888 3:130814094-130814116 AAGCAGACCCCAGCAGGTTGCGG + Intergenic
963296719 3:143554706-143554728 GAGAAGAGGTCAGCAAGTTGTGG - Intronic
963660183 3:148115453-148115475 AACCAGAGCTCATCTGATTGAGG + Intergenic
966024491 3:175259284-175259306 AAGCAGACCTGAGCTGGTGGAGG + Intronic
966116114 3:176463428-176463450 AAGCTGAACTCAGCTATGTGGGG + Intergenic
969295298 4:6266706-6266728 ATGCAGAGCTCAGCTCTTGGGGG + Intergenic
969589769 4:8115069-8115091 AAGCAGAGCCAAGCTGTTTGCGG - Intronic
969612819 4:8236619-8236641 AAGCAGAGCTCAGCCAGGCAGGG - Intronic
972450466 4:39192916-39192938 AAGCACAGCCCAGCTCATTGAGG + Intronic
975823828 4:78299217-78299239 AAGGAGAGCTCAGTTTGTGGGGG + Intronic
978339421 4:107706880-107706902 AGGCAGAGCTCAGCTGGTGCTGG + Intronic
978845900 4:113272248-113272270 AAGCAGAGCTCACCTACTTCCGG + Intronic
984221195 4:176978917-176978939 AAGCAAAGCTTGCCTAGTTGGGG - Intergenic
984946308 4:184971328-184971350 AGGCTGAGCTCAGCGAGGTGGGG - Intergenic
986074962 5:4326914-4326936 AAGCAGAGGGCAGCAGGTTGAGG - Intergenic
988318386 5:29660769-29660791 AAGAAGTGCTCAGCTGGGTGTGG - Intergenic
992268476 5:75041334-75041356 AAACAGAGCTCCTTTAGTTGAGG - Intergenic
995256979 5:110058132-110058154 AACCAGAGCTCAGGTAGGTATGG - Intergenic
998522571 5:142814083-142814105 AAGCAAAGCTTACCTACTTGTGG - Intronic
1000200833 5:159009049-159009071 AAGCAGAGCTCCTGTAGTTGAGG - Intronic
1004896534 6:20153358-20153380 AAACAGAGCTCAGTTAGCTTAGG - Intronic
1006106755 6:31721497-31721519 CAGGAGAGCTGAGCCAGTTGGGG + Intronic
1008069307 6:47083701-47083723 AAGTAGAGCCCAGCTGGCTGTGG + Intergenic
1009662078 6:66626649-66626671 ATGCATAGATCAGCTATTTGAGG - Intergenic
1014674996 6:124353336-124353358 AAGCAGGGCTCAGCCAATTCTGG + Intronic
1015432722 6:133150133-133150155 AAGCAGAGAGCAGTTAGGTGTGG + Intergenic
1015836828 6:137429542-137429564 AAGCAGAGCTCAGCTGGAAGTGG - Intergenic
1016998225 6:149976217-149976239 AGGCAGAGCGCAGGGAGTTGGGG + Intergenic
1018754990 6:166841177-166841199 CAGCAGAGCCCAGGAAGTTGAGG + Intronic
1019206958 6:170369792-170369814 CAGGAGAGCTCAGTTACTTGGGG + Intronic
1021841700 7:24726415-24726437 TAGCAGAACTCAGGTATTTGTGG - Intronic
1021878063 7:25066944-25066966 AAGCAAAAATCAGCCAGTTGTGG - Intergenic
1021988281 7:26118353-26118375 AAGCTGAGCCCAGGAAGTTGAGG - Intergenic
1022950865 7:35336744-35336766 AAGCTGAGCCCAGCTAGGAGTGG + Intergenic
1026588491 7:71677163-71677185 CATGAGAGCTCAGCTAGTGGAGG - Intronic
1032109561 7:129063906-129063928 AATTATAGCTCACCTAGTTGGGG + Intergenic
1032658484 7:133956542-133956564 CAGCTGAGCACAGCTACTTGAGG - Intronic
1033861019 7:145627962-145627984 AAACAGAGCCCAGATTGTTGTGG + Intergenic
1033956028 7:146849524-146849546 GAGCAGAGTTCAGATATTTGAGG - Intronic
1034702748 7:153110737-153110759 AGACAGACCTCAGCTAGATGCGG - Intergenic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1037295519 8:17396439-17396461 AAGGAGAGCATAGCTACTTGAGG + Intronic
1038272472 8:26086686-26086708 AAGCAGAGCTGAGCTGTTTAAGG + Intergenic
1039426096 8:37487467-37487489 AAGTACAGCTCAGTTATTTGTGG + Intergenic
1042913529 8:73851374-73851396 AAGAAGAGATCAGCTAGATGCGG + Intronic
1044979692 8:97704160-97704182 AAGAAGAGCTAAGCTAGTGGAGG - Intronic
1045736758 8:105305080-105305102 AAGCAGAGATCTGCTAGGTGAGG - Intronic
1045896780 8:107227916-107227938 AAGCAGATTTCAGATACTTGGGG + Intergenic
1058852080 9:109022248-109022270 AAGTAGAGCTGTGCTAGTAGAGG - Intronic
1058914552 9:109553178-109553200 AAGCTGTGCTCAGCCAGGTGCGG - Intergenic
1058945684 9:109853842-109853864 AAGCTGAGCTCTGCTGTTTGGGG + Intronic
1061870793 9:133519274-133519296 AAACAGACCACAGCTGGTTGTGG + Intronic
1189622416 X:42856371-42856393 AGGCAGATCTCAGGTAGTGGTGG - Intergenic
1194572200 X:95566870-95566892 AAACATAGCTCAGCCAGGTGGGG + Intergenic
1195165871 X:102219932-102219954 ATGCAGTGCTCAGCTACCTGGGG + Intronic
1195192988 X:102467159-102467181 ATGCAGTGCTCAGCTACCTGGGG - Intronic
1198380261 X:136076999-136077021 AAGGAAAGCTCAGTAAGTTGGGG - Intergenic
1199374430 X:147090237-147090259 AAACTGAGCTCACCTAGTTACGG + Intergenic
1200855213 Y:7930616-7930638 AGGCAGAGCTCAGGTAGATGAGG + Intergenic
1200904626 Y:8469165-8469187 AGGCAGGGCTCAGGTAGATGAGG - Intergenic
1201699771 Y:16867828-16867850 AAGCAGAGATCAGATATATGGGG - Intergenic
1202264170 Y:23000645-23000667 AGGCAGAGCTCAGGCAGATGAGG - Intronic
1202264190 Y:23000803-23000825 AGGCAGAGCTCAGGCAGGTGAGG - Intronic
1202264210 Y:23000959-23000981 AGGCAGAGCTCAGGCAGGTGAGG - Intronic
1202417162 Y:24634387-24634409 AGGCAGAGCTCAGGCAGATGAGG - Intronic
1202417182 Y:24634545-24634567 AGGCAGAGCTCAGGCAGGTGAGG - Intronic
1202417202 Y:24634701-24634723 AGGCAGAGCTCAGGCAGGTGAGG - Intronic
1202453585 Y:25035385-25035407 AGGCAGAGCTCAGGCAGGTGAGG + Intronic
1202453605 Y:25035541-25035563 AGGCAGAGCTCAGGCAGGTGAGG + Intronic
1202453625 Y:25035699-25035721 AGGCAGAGCTCAGGCAGATGAGG + Intronic