ID: 936759836

View in Genome Browser
Species Human (GRCh38)
Location 2:115763747-115763769
Sequence TTGTGGAAGTGCAAGTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936759836 Original CRISPR TTGTGGAAGTGCAAGTATGA GGG (reversed) Intronic
900851747 1:5148974-5148996 TTGTGAAGGAGCAAGTATAATGG - Intergenic
904693153 1:32309953-32309975 TTGGGGAAGTGCAAGCAAAATGG + Intronic
904876453 1:33658223-33658245 TTGTGGCAATGCACGGATGATGG - Intronic
906831194 1:49033617-49033639 TTGTGGAAAAGCAAGGATGTCGG - Intronic
909935112 1:81542180-81542202 TTGTGAATGTGCAAGTCTGATGG - Intronic
914343030 1:146776427-146776449 ATGTGGAAGTGCATGGATGAAGG + Intergenic
915263649 1:154698304-154698326 TTGTGGAATTGTGAGTAGGAAGG - Exonic
918481738 1:184985444-184985466 TATTGGAAATGCAAGTACGAAGG + Intergenic
921287478 1:213622144-213622166 TGGTGGAAGTACAAATATGCAGG - Intergenic
921751883 1:218804167-218804189 TTCTGGAAGTAAAAGGATGATGG + Intergenic
922017934 1:221671088-221671110 TTGTGGAAGAGTAAGGATGCTGG - Intergenic
923012867 1:230102832-230102854 TTGTGGCAGGGCAAGGATGGAGG + Intronic
1063194227 10:3726217-3726239 TTCTGGAAGTGCAGGTCTAATGG + Intergenic
1065415013 10:25474846-25474868 TTGTGGAAGACTAAGAATGAGGG + Intronic
1065626054 10:27629807-27629829 TTAGGCAAGTGCAAGGATGAGGG + Intergenic
1069860558 10:71468615-71468637 TTGTGGAAGGGCACCTAGGAGGG - Intronic
1070125449 10:73617965-73617987 TTCTGGGAGTGCAAGGTTGACGG + Intronic
1070547238 10:77462562-77462584 GTGTGTAAGTGCATGTGTGAGGG - Intronic
1071437258 10:85658980-85659002 TTGTGGAAGTGCAAAGATAATGG + Intronic
1072213605 10:93269509-93269531 TTCTGGAAGTGGAATTATCAGGG + Intergenic
1072621615 10:97083407-97083429 TTCTGGAAGTGTATGTATGTCGG + Intronic
1073850837 10:107616400-107616422 TTCTGGAAGTGAATGCATGAAGG + Intergenic
1074438732 10:113456489-113456511 ATGGAGAAGTGCAAGTATGCAGG + Intergenic
1085433593 11:76479400-76479422 CTGTGGAAGTGCTTGTGTGAGGG - Intronic
1086151789 11:83619658-83619680 TTGTGGAGGTGGAAGTATCATGG + Intronic
1087846704 11:102981902-102981924 TTGTGGGAGAGCAAATATGTAGG + Intergenic
1091034519 11:132221250-132221272 TGGTGGATGTGCAAGAATGTCGG + Intronic
1092176392 12:6411094-6411116 TGGAGGAAGGGCAATTATGAAGG - Intergenic
1095424074 12:42056316-42056338 CTGAGGAAGTGAAAGTCTGAAGG - Intergenic
1095973403 12:47921776-47921798 CAGTGGAAGTGACAGTATGAGGG - Intronic
1096530029 12:52236596-52236618 TTGAGGGAGTGCAACTTTGAGGG + Intronic
1097766108 12:63528890-63528912 TTGGGGAAGTGAAAGTGAGAAGG + Intergenic
1102832253 12:116013903-116013925 TTGTGGAGGTGTAAGGTTGATGG + Intronic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106874505 13:34056988-34057010 TTGTGGAAATGCAAGTATAAAGG - Intergenic
1108181313 13:47842420-47842442 TTGAGGAAGAGTAAGAATGAGGG - Intergenic
1110914329 13:81002590-81002612 GTGTGGCATTGCAAATATGAGGG - Intergenic
1111226727 13:85283192-85283214 TTGTAGAAGAGAAAGTATGGTGG + Intergenic
1115838293 14:37434953-37434975 TTGTTGAAATGCACGTGTGATGG - Intronic
1116690267 14:48097247-48097269 TTGTGGAAGTGCTTGCATGGGGG + Intergenic
1117093916 14:52277962-52277984 CTGTGGAAGTTCAGGTGTGAGGG - Intergenic
1120348642 14:83324589-83324611 TTGTGGAAGTGAAATTATTAGGG + Intergenic
1122999368 14:105284148-105284170 TTGTGGACGTGCATGTGTGTTGG - Intronic
1126324762 15:47464569-47464591 TTGAGGAGGTGCCAGTATGCAGG + Intronic
1130536871 15:84792093-84792115 TTCTTGAAAGGCAAGTATGATGG + Intronic
1130631586 15:85574808-85574830 ATGAGGAAGTGCAAGGAAGATGG - Intronic
1131926597 15:97391237-97391259 TTGTGGAAGAGAAAGTAGGATGG + Intergenic
1132172332 15:99672991-99673013 TTGTGGATGTGCTTGTGTGAGGG + Intronic
1133412339 16:5579194-5579216 TAGTGGAAGTGCAAGTTGGGTGG - Intergenic
1133657260 16:7877857-7877879 TTTTGGAAGACCAAGTATAAAGG - Intergenic
1136381497 16:29898151-29898173 GTGTGGGAGTGGGAGTATGAGGG - Intronic
1138116638 16:54366174-54366196 TTCTCCAAGTGCAAGTCTGAAGG + Intergenic
1138133460 16:54501519-54501541 TTATAGCAGTGCAAGAATGAGGG - Intergenic
1139990956 16:70938901-70938923 ATGTGGAAGTGCATGGATGAAGG - Intronic
1140451135 16:75071687-75071709 TTCTGGAAGTGCATGTGGGACGG + Intronic
1140648200 16:77057224-77057246 TTATGTTAGTGCAAGTATTAAGG - Intergenic
1140783416 16:78316978-78317000 TGCTGGAAGTGCAAAGATGAAGG + Intronic
1141746072 16:85927285-85927307 TTATGGAAGTGAAGGTACGATGG + Intergenic
1141755370 16:85987502-85987524 GTGTGGCAGTGCAAGGATGTTGG + Intergenic
1141755766 16:85989577-85989599 GTGTGGCAGTGCAAGGATGTTGG + Intergenic
1143286521 17:5793955-5793977 GTGTGGAAAGGCAAGTCTGAAGG - Intronic
1145296142 17:21593771-21593793 TTGTGGAAGTGCAGGGTTGGGGG - Intergenic
1147368876 17:39977696-39977718 TTGGGGAAGTATAAGTAGGAGGG - Exonic
1147933183 17:43995493-43995515 TTGTGGAAGGGCATGTGGGATGG - Intronic
1148935397 17:51160960-51160982 TTGTAGAAAGGCAAGCATGAGGG + Intronic
1150241517 17:63637645-63637667 TTGTGGAACTGAAAGGATTAAGG + Intronic
1152886520 17:82854361-82854383 TTGTGGACGTGCTTGCATGAGGG - Intronic
1154109892 18:11558154-11558176 TTCTGGTAGGGCAAGTAGGATGG + Intergenic
1156246318 18:35302685-35302707 TTCTGGAAGAGGAAGTATAAGGG + Intergenic
1157624761 18:49042128-49042150 TTGTGGCAGAGCCAGTCTGAAGG - Exonic
1158553631 18:58458039-58458061 TTGAGGAACTGCAGGGATGAGGG - Intergenic
1165641390 19:37390541-37390563 TTCTGGAACTGCAAGTTTCAAGG + Exonic
925846758 2:8041922-8041944 TTGTAGAATTGCAGTTATGATGG - Intergenic
927554037 2:24020169-24020191 TTGGGGAAGGGAAAGTATCAAGG + Intronic
928049731 2:27978494-27978516 TTGTGGAAACGCCAGTTTGAAGG - Intronic
928246386 2:29632271-29632293 TAGTGGGAATGCAAGTATTATGG + Intronic
929341531 2:40824803-40824825 TAATGGAAGTGGAAGTATGAGGG + Intergenic
930575019 2:53135968-53135990 CTATGGAAGAGCAAGTTTGAAGG + Intergenic
932627114 2:73306392-73306414 TTCTGGAAGAGCAAGTGGGATGG + Intergenic
936759836 2:115763747-115763769 TTGTGGAAGTGCAAGTATGAGGG - Intronic
938377740 2:130819681-130819703 GAGTGGAAATGCACGTATGAGGG + Intergenic
938652380 2:133396841-133396863 CTGTGGAACTGTAAGTATAATGG + Intronic
942425962 2:175861112-175861134 TGGTGGAATTGAAAGAATGAAGG + Intergenic
942598457 2:177616122-177616144 TTTTAGAAGTACAAGTATAATGG - Exonic
945211503 2:207388034-207388056 TTGTAAAAGTCCAAGAATGAAGG + Intergenic
946470407 2:219955032-219955054 TTCTTGTAGTGCAGGTATGATGG + Intergenic
948300388 2:236902080-236902102 ATGTTGAAGTTCAAGTGTGATGG - Intergenic
948534117 2:238633316-238633338 TTGTGGGTGTGCATGCATGAAGG + Intergenic
1170747616 20:19114721-19114743 TTGTGGAAGTGGACATCTGAGGG - Intergenic
1171394761 20:24824801-24824823 TGGTGGAAGTGGAAGTCGGAGGG - Intergenic
1172053653 20:32139072-32139094 TTGAGGAAGGGCATGGATGAAGG - Intronic
1175227672 20:57454206-57454228 TGGGGGAAGAGCAGGTATGAGGG + Intergenic
1177534502 21:22406391-22406413 TTGTTGAAGGACAAGTATAAAGG + Intergenic
1180109057 21:45639375-45639397 TTGTGGAGATGCCAGTCTGAGGG + Intergenic
951148942 3:19264636-19264658 TTGAAGAAGTGAAAGTATGGAGG - Intronic
951221041 3:20069290-20069312 TTGTGGGAAGGCAAGTATGTGGG + Intronic
951740047 3:25911636-25911658 TTGTGGCAGTGCAAATATAAAGG - Intergenic
951903983 3:27685513-27685535 TTTTGGAAGAGCATGTAGGATGG - Intergenic
953969662 3:47337202-47337224 TAGTGGAAGTGCATGTGTGAGGG - Intronic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
954921152 3:54192173-54192195 TTCTGGAAGTGGGAGGATGAAGG - Intronic
958099243 3:88988001-88988023 TTGTGGCAGTGAAGCTATGAAGG + Intergenic
958858037 3:99410491-99410513 TTGAGGATGTGAAAATATGAGGG + Intergenic
959080328 3:101794171-101794193 TGCTGGAAGTGGAAGTTTGAGGG + Intronic
960472866 3:118089163-118089185 TTATGGCAGTACAAGTATTAGGG - Intergenic
961167755 3:124775328-124775350 GTGTTGGAGTGCAAGTGTGAGGG + Intronic
961617986 3:128198755-128198777 ATGTGGAGGTGCAGGTCTGAAGG + Intronic
961939271 3:130620526-130620548 TGGTGGAAGTGAAAGTTAGAAGG + Intronic
962019293 3:131480197-131480219 ATGTGGAAATGCAAGTAAGTAGG - Intronic
964109268 3:153072486-153072508 TTGTGGAGGTGCAAGAATAGAGG - Intergenic
964418821 3:156479261-156479283 TTGTGGAAGTGACAGAATTAGGG - Intronic
965506428 3:169520365-169520387 TCCTGGAAGTCCAAGGATGAGGG - Intronic
966023475 3:175245048-175245070 TTATGGAAGTCCAAGAAAGAGGG - Intronic
966201242 3:177361372-177361394 TTTTAGAAGTGCAAGTCTGGTGG - Intergenic
967765461 3:193274473-193274495 GTGTGGAAGTGGTAGAATGAAGG - Intronic
971448911 4:26781206-26781228 TGGTGCAAGTCCAAGTTTGAGGG + Intergenic
971607421 4:28676047-28676069 ATGTGGTAGTGTAAGGATGAAGG + Intergenic
974481487 4:62449467-62449489 ATGTGGCAGAGCAACTATGAAGG + Intergenic
975130906 4:70831839-70831861 TTCTGGAAATACAAGTATGTAGG - Intronic
976098022 4:81529287-81529309 TTGTGTAAGTGGATGGATGATGG + Intronic
976504401 4:85830478-85830500 TTGTAGAAGTGTAACTATGTCGG - Intronic
977781086 4:100981594-100981616 TTGTGGAAGTGTGAGAATGGAGG - Intergenic
978784390 4:112593311-112593333 TTGTGGCAGTGAAAGTATAGTGG - Intronic
978958607 4:114646859-114646881 TTGTGGAAGTGCATTTCTGCAGG - Intronic
979324039 4:119358168-119358190 GTGTGTATGTGCATGTATGAAGG + Intergenic
979808368 4:125003450-125003472 TTGTGAAAGAGAAAGAATGAAGG - Intergenic
979834951 4:125354681-125354703 GTGTGGAAATGGAAGAATGAAGG + Intronic
980182026 4:129413123-129413145 TTATGGATGTGCAGGGATGATGG + Intergenic
981083370 4:140657551-140657573 CTGTTGAACTGCAAGGATGATGG - Exonic
981835689 4:149050868-149050890 GGGTGGAAGTGAAATTATGAGGG - Intergenic
982128544 4:152205830-152205852 TTGTGGAATTGCAGGCATGTGGG - Intergenic
983122401 4:163902970-163902992 ATTTGGAAGTGCAAGTATGGTGG - Intronic
983241877 4:165242854-165242876 GTGTGTATGTGCATGTATGAAGG + Intronic
984548770 4:181136371-181136393 ATGTGGAAGTTCAAGTGAGAGGG - Intergenic
988923363 5:35964367-35964389 ATGTGGAGGTGCAAGTGAGATGG - Intronic
989775218 5:45198618-45198640 TTATGGAAGTAAAAGTATCATGG - Intergenic
991586954 5:68211333-68211355 TTGTGGAACTTCAAATTTGAGGG - Intergenic
992279890 5:75163423-75163445 TTGTGGATGTGCTTGCATGAAGG + Intronic
993571461 5:89544753-89544775 CTGTGGAAGTGCCAATATTATGG - Intergenic
994131056 5:96227887-96227909 ATGTGTAAGGGCAAGTATGGTGG + Intergenic
994994145 5:107038227-107038249 TTGAGAAAGTGCAAATGTGAAGG - Intergenic
996236039 5:121130418-121130440 ATGTGGAAGTGAAAATATAAAGG - Intergenic
1001017535 5:168154840-168154862 TTGTGTAGATGCAAGTATGGGGG - Intronic
1003191566 6:3879594-3879616 TTGTGGAAGGACAGGGATGAAGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1005421379 6:25654922-25654944 TTGTGTAGGTACAAGAATGAAGG - Intronic
1005570103 6:27136860-27136882 TTGTGGAAATGTAACTATGTAGG + Intergenic
1006292462 6:33149859-33149881 ATGTGGAGGGGAAAGTATGAAGG + Intergenic
1007143922 6:39608106-39608128 TTGTGGAAGTGCAAATAATTGGG - Intronic
1007509464 6:42364214-42364236 ATGGGGAAGAGCAAGTATGGAGG - Intronic
1007804285 6:44427801-44427823 TTTTGAAAGTGAAAATATGAGGG + Intronic
1007859998 6:44898669-44898691 CTGTGGCAGTGCAAGAATGCAGG - Intronic
1008813475 6:55534304-55534326 TTCTGGAAGAGCAAGTGGGAGGG - Intronic
1008852626 6:56042119-56042141 TTGTGGTAGTGCAGGTCTGCTGG - Intergenic
1010209217 6:73349668-73349690 TTTTGGAAGTAAAAGTCTGAAGG - Intergenic
1010972089 6:82273868-82273890 TTGTGGAAGTAAAATTTTGAGGG + Intergenic
1011446689 6:87449108-87449130 TTATGGAAATGCAAGTTTGATGG - Intronic
1012632048 6:101482724-101482746 TTGAGGTAGTGGAAGTAGGAAGG + Intronic
1013935748 6:115590890-115590912 TTGTGTATGTGCATGTGTGAAGG - Intergenic
1014021679 6:116598001-116598023 TTGTGGAAGTCCAAGGAAGTCGG + Intergenic
1014338320 6:120168363-120168385 TTCTGGTAGTGAAAGTATGATGG + Intergenic
1014905529 6:127022380-127022402 TTGTGGAGGTGCACGTATTTTGG - Intergenic
1015308644 6:131739462-131739484 TTGTGGAAGTGCACGGCTGGAGG + Intronic
1018386251 6:163305986-163306008 CTGCTGAAGTGCAAGAATGATGG - Intronic
1020181559 7:5926634-5926656 CTGTTGAAATGCAGGTATGAAGG - Intronic
1020301374 7:6798255-6798277 CTGTTGAAATGCAGGTATGAAGG + Intronic
1021251995 7:18340888-18340910 TTGTTGAAGTCCAAGTCTGCTGG + Intronic
1024397031 7:48881702-48881724 TTCTGGAAGTGCAAGATTGAGGG + Intergenic
1027688184 7:81304594-81304616 TTCAGGAGGTGCAAGTTTGAAGG - Intergenic
1027708032 7:81559029-81559051 TTGCAGAAGTGCAACTATGAAGG + Intergenic
1028309307 7:89310255-89310277 TTGAGGAGGTGTAAGTATCATGG + Intronic
1028706242 7:93850415-93850437 TTGTGGAAGTCAAAGAATGCAGG - Intronic
1030172137 7:106613592-106613614 TTGTGAAAATGCAACTATTATGG - Intergenic
1030479695 7:110087263-110087285 ATGTTGCAGTTCAAGTATGAAGG - Intergenic
1031696849 7:124867259-124867281 TTGTTGAAGAACAAGCATGAAGG - Intronic
1032674829 7:134119997-134120019 TGGTGTAAGTGCCAGTCTGAAGG - Intergenic
1033968514 7:147008733-147008755 TTGTGGAAAGGCAAATATGTAGG + Intronic
1034128113 7:148692106-148692128 ATGTTGAAGTTCAAGTGTGAAGG - Intergenic
1034262842 7:149767397-149767419 TTGTGGAAGTCCACGTGTGATGG - Intronic
1034548367 7:151804080-151804102 TTATGCAAATGCAAATATGAAGG + Intronic
1038136972 8:24796853-24796875 TTGTGGATGAGCCAGTTTGAGGG - Intergenic
1038255528 8:25947693-25947715 TTGTGCATGTGCAAGAAAGAAGG - Intronic
1038804732 8:30779644-30779666 TTTTTGTAGTGCAAGTTTGATGG - Intronic
1039249313 8:35643950-35643972 TTGTGTAGGTGTAAGTATTATGG - Intronic
1040015495 8:42696028-42696050 TTGTGGGAATGCAAGGAGGAAGG - Intergenic
1040486951 8:47882652-47882674 ATGTGGGTGTGCATGTATGATGG - Intronic
1041292167 8:56318431-56318453 CTGTGGATCTGCAAGGATGAGGG + Intronic
1041988350 8:63954307-63954329 TTGTGGAAGCGGGAGCATGAAGG + Intergenic
1042290323 8:67164142-67164164 TTGGGGGAGTGCAACTATAAAGG - Intronic
1043651155 8:82594266-82594288 TTGTGGAAATGAAAGTAAAAAGG + Intergenic
1044619555 8:94175688-94175710 TTGTGGAAGTGAAAGGTAGAAGG + Intronic
1046792020 8:118332759-118332781 TTGTGATGGGGCAAGTATGAGGG - Intronic
1048856626 8:138691954-138691976 TTGTGGAGGTGCATGTGTGGAGG + Intronic
1051500841 9:17776101-17776123 TGCTGGAAGAGCAAGGATGAGGG - Intronic
1055164785 9:73177840-73177862 TTGTGAATGTGGAAGAATGAAGG - Intergenic
1057055112 9:91954478-91954500 TTGTGGAACTACACGGATGATGG - Intergenic
1058257190 9:102781628-102781650 TTATGGAAATTCAAGTATAACGG - Intergenic
1059672156 9:116501926-116501948 GTGTGCAAGTGCGAGTATGGAGG - Intronic
1186326055 X:8477814-8477836 TTCTTGAAGTGCAGGTCTGATGG + Intergenic
1186927943 X:14355915-14355937 TTGGGGAAAAGAAAGTATGAAGG - Intergenic
1187441108 X:19321034-19321056 ATGTTGAAGTTCAAGTTTGAAGG + Intergenic
1189466681 X:41282939-41282961 TTTTGCAAGTGCATATATGAAGG + Intergenic
1189629505 X:42937282-42937304 ATGTAGAAAAGCAAGTATGATGG - Intergenic
1190524603 X:51315935-51315957 TTGTGAAAGTACAAATATGGAGG - Intergenic
1190739068 X:53277144-53277166 TTCTGGAAGTTCTGGTATGATGG - Intronic
1193022623 X:76806824-76806846 TTGTGCAAGTGTAACTATGCTGG - Intergenic
1194183289 X:90739183-90739205 TTTTGGAAAAGCAAATATGAGGG + Intergenic
1194905780 X:99575128-99575150 TTGTGGATTTTCAAGTATCATGG - Intergenic
1201070543 Y:10143955-10143977 GTGAGGAAGTCCAAGGATGAGGG - Intergenic
1202253060 Y:22892948-22892970 CTGTGTGAGTCCAAGTATGAGGG + Intergenic
1202406050 Y:24526697-24526719 CTGTGTGAGTCCAAGTATGAGGG + Intergenic
1202464730 Y:25143384-25143406 CTGTGTGAGTCCAAGTATGAGGG - Intergenic