ID: 936760666

View in Genome Browser
Species Human (GRCh38)
Location 2:115777031-115777053
Sequence CTATAAACACAGATCAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936760666_936760669 4 Left 936760666 2:115777031-115777053 CCTGCCTTGATCTGTGTTTATAG 0: 1
1: 0
2: 0
3: 13
4: 207
Right 936760669 2:115777058-115777080 GCATGTTCATTCTTGAGCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936760666 Original CRISPR CTATAAACACAGATCAAGGC AGG (reversed) Intronic
901369648 1:8785920-8785942 TTAAAAAAACAGCTCAAGGCAGG - Intronic
905057327 1:35107149-35107171 TTTTAAAAACAGAACAAGGCCGG - Intronic
905766318 1:40604571-40604593 CTGTAATCCCAGGTCAAGGCAGG - Intergenic
906221631 1:44084776-44084798 CTAAAAACATACATGAAGGCAGG + Intergenic
906685424 1:47760239-47760261 CTTTAAACACAGCTCAAATCTGG - Intergenic
909071298 1:70996823-70996845 CTAAAAACACAAAAAAAGGCTGG - Intronic
910347659 1:86258934-86258956 TCTTAAACACAAATCAAGGCAGG - Intergenic
910535440 1:88292391-88292413 CTACAAATACAGGTCAAGGTAGG - Intergenic
913271438 1:117097566-117097588 CTATAGATACAGATCTAAGCAGG + Intronic
914765148 1:150630789-150630811 CTAGAAATACAAAACAAGGCTGG + Intergenic
915238813 1:154504776-154504798 TTAAAAACACAGATAAAGCCTGG + Intronic
915789711 1:158654952-158654974 CTATAAACCCAAAGCAAGGAAGG + Intronic
920909973 1:210207341-210207363 CTACAAAGACAAATCTAGGCCGG + Intergenic
921040276 1:211424446-211424468 CTAAAAACAAAATTCAAGGCTGG - Intergenic
922222778 1:223621172-223621194 TTATAAACAAAGATTAGGGCAGG + Intronic
924535161 1:244929254-244929276 CTCTAAATACAGATCAGGCCAGG - Intergenic
1063829198 10:9932725-9932747 CTTTAATCACAGGTGAAGGCTGG - Intergenic
1063844486 10:10110825-10110847 CTAAAAACAAAGAACAGGGCCGG - Intergenic
1064004033 10:11686342-11686364 TTAAAAACACAGCACAAGGCTGG + Intergenic
1064797409 10:19028760-19028782 ATAGAAACACAGATTTAGGCAGG - Intergenic
1064960714 10:20961876-20961898 CTAAAAACACAGATCTCAGCCGG + Intronic
1065274893 10:24075898-24075920 CAATAAAAATAGATTAAGGCTGG - Intronic
1067515520 10:46938243-46938265 CTTTAAAGAAAAATCAAGGCCGG - Intronic
1067646731 10:48113572-48113594 CTTTAAAGAAAAATCAAGGCCGG + Intergenic
1067714353 10:48677739-48677761 CTAAAAGAACAGAACAAGGCTGG + Intergenic
1069841643 10:71343260-71343282 CTTTAAAAACAAAACAAGGCTGG - Intronic
1070205860 10:74260507-74260529 CTATAATCACAGGCCAAGGCAGG - Intronic
1071100079 10:82026259-82026281 CTGTAATGACAGCTCAAGGCAGG - Intronic
1071996271 10:91152798-91152820 CTAGAAACACAGATAACTGCTGG - Intergenic
1072126812 10:92453312-92453334 ATATAAACACAGATGATGACTGG - Exonic
1073553391 10:104424908-104424930 CTAAAAACATACATTAAGGCAGG + Intronic
1074501830 10:114032450-114032472 TTATAACCACAGAACAAAGCTGG - Intergenic
1077810183 11:5628978-5629000 ATAAAAACACAGGTCAAGGCCGG + Intronic
1078509026 11:11972152-11972174 TTAAAAACAAAGATGAAGGCAGG + Intronic
1079801318 11:24873150-24873172 CTAAAAGCACAGATCACAGCAGG + Intronic
1081582301 11:44360619-44360641 CTAGAAACACTGATGTAGGCAGG - Intergenic
1082826060 11:57579802-57579824 CTCAAAAAACAGAACAAGGCTGG + Intergenic
1083519686 11:63296778-63296800 CTATAAACCCAGATCAACAATGG + Intronic
1084344481 11:68536117-68536139 GTATAAACACTGATCAATCCAGG - Intronic
1084912452 11:72401959-72401981 TAAAAAACACAGATCATGGCTGG + Intronic
1089096827 11:115926543-115926565 CTATAAAGACATACCAAGACTGG - Intergenic
1089726689 11:120486815-120486837 CTAAAAACACAGATCAATTTAGG - Exonic
1090268704 11:125370924-125370946 CTAGAACCACAGATGAAGGAAGG + Intronic
1091806825 12:3362828-3362850 CTGTAAATACAGGCCAAGGCTGG + Intergenic
1092805902 12:12222267-12222289 ATATAAAGAAAGATCACGGCCGG + Intronic
1092970281 12:13687161-13687183 CTATAAAGAAAACTCAAGGCTGG - Intronic
1095950784 12:47780861-47780883 CTAAGAAAACAGATCCAGGCCGG - Exonic
1096736623 12:53660551-53660573 TAAGAAACACAGATTAAGGCTGG + Intronic
1098361954 12:69663530-69663552 ATTAAAACGCAGATCAAGGCTGG + Intronic
1098526647 12:71494240-71494262 CTACAAAAAAAAATCAAGGCCGG - Intronic
1099265247 12:80438096-80438118 CTATAAACAGAGATCAAAACTGG - Intronic
1099341716 12:81445187-81445209 CTATAAAGAAAGACCAAGGTGGG + Intronic
1099345417 12:81493819-81493841 ATAGAAACATAGATGAAGGCAGG + Intronic
1101906156 12:108828031-108828053 CTAAAAACACAGCTCTTGGCTGG - Intronic
1101907855 12:108841002-108841024 ATATAAACACAGATCTAGATTGG + Intronic
1102464060 12:113117926-113117948 CTATAAACAAGAATGAAGGCTGG + Intronic
1103001862 12:117390879-117390901 CTATGAAAACAGACCAAGGTTGG - Intronic
1103047013 12:117744518-117744540 CTATAAACAAAGTTCTAGGTTGG - Intronic
1103680873 12:122692595-122692617 TTAAAAACCCAGATCCAGGCCGG - Intergenic
1105384058 13:19913858-19913880 CTATCAACATAGATGCAGGCAGG - Intergenic
1105678498 13:22701778-22701800 TTTAAAACACAGACCAAGGCCGG - Intergenic
1106074072 13:26442187-26442209 CTCTATACACAGATCATGCCTGG + Intergenic
1107754688 13:43607533-43607555 CACTAAACACACATCAAGCCAGG - Intronic
1108259125 13:48639448-48639470 GTATAAAAACAGAAAAAGGCCGG + Intergenic
1113412031 13:110098720-110098742 ATATAAACATAGATAAAGACAGG + Intergenic
1114293156 14:21305562-21305584 TTAAAACCACAGATCCAGGCCGG + Intronic
1114717790 14:24845804-24845826 ATATAAACACAAAGGAAGGCAGG + Intronic
1115626364 14:35196784-35196806 CTCTTAACACATGTCAAGGCAGG - Intronic
1116850350 14:49902832-49902854 AAAAAAAAACAGATCAAGGCGGG - Intergenic
1118149604 14:63175398-63175420 CTATAATTCTAGATCAAGGCAGG - Intergenic
1121365435 14:93304646-93304668 CTTTAAACTCAAATCTAGGCCGG - Intronic
1124529409 15:30491316-30491338 CTCAAATGACAGATCAAGGCAGG + Intergenic
1131876877 15:96816964-96816986 CTATAAAAACATAACAAGGCAGG - Intergenic
1132438268 15:101831149-101831171 GTATAACCAGATATCAAGGCTGG + Intergenic
1137301017 16:47147365-47147387 CTAAAGTCTCAGATCAAGGCAGG - Intergenic
1139323541 16:66134398-66134420 CTCTTAACCCAGATGAAGGCGGG + Intergenic
1139369258 16:66456095-66456117 CTAGGAACACAGCTCTAGGCTGG + Intronic
1139581358 16:67875766-67875788 CCATAAACACTGATGTAGGCAGG - Intronic
1140795301 16:78432004-78432026 ATATAAACACAGGTCATGTCTGG - Intronic
1140911322 16:79455719-79455741 CAATAAAAACAAATTAAGGCTGG + Intergenic
1141154766 16:81589643-81589665 CTATGGACACAGACCATGGCAGG - Intronic
1144653155 17:17019457-17019479 CTAAAAACACAAATCGAGTCTGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146496182 17:33324552-33324574 CTGTACACACAGATCTAGGTAGG - Intronic
1146769855 17:35558912-35558934 CTATAAACACAAACATAGGCTGG + Intergenic
1148732645 17:49846868-49846890 CTATAAAAGCATATCAAAGCTGG + Intronic
1151232999 17:72698092-72698114 AGATAAACACAGATCATAGCTGG + Intronic
1152182778 17:78834723-78834745 CTACAAAAACAAATCAAGGCCGG - Intronic
1152214007 17:79021826-79021848 CTAGAAAGACAGCTGAAGGCTGG - Intergenic
1153227377 18:2909065-2909087 CTATTAGCACAAATCAAGCCTGG + Intronic
1155181002 18:23346414-23346436 CTATAAAAATAGTTGAAGGCAGG - Intronic
1155445693 18:25910976-25910998 CCATAAATACAGATCAAGGTGGG + Intergenic
1156566325 18:38195656-38195678 CTGTAAACAGAAATCAAGGAAGG - Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1157081703 18:44532642-44532664 CTATAAACTCAGATCAGAGTGGG + Intergenic
1157347754 18:46855055-46855077 CTATAAATTCAAATCAAGCCTGG + Intronic
1157823600 18:50792020-50792042 GTATAATCACAGATCCAGGTAGG + Intergenic
1160730023 19:637537-637559 CAACAAACACCGATCAGGGCTGG - Intergenic
1161636189 19:5390764-5390786 ATAGAAACTCAGATCAGGGCTGG - Intergenic
1162414422 19:10526436-10526458 CTAAAAACACAAAAAAAGGCTGG - Intergenic
1162431811 19:10633454-10633476 CTCAAAAAACAAATCAAGGCTGG - Intronic
1163067107 19:14805575-14805597 CTAAAAATACAAAACAAGGCCGG - Intronic
1165223228 19:34334929-34334951 CTATAATCCCAGCTTAAGGCAGG + Intronic
1166772813 19:45294510-45294532 CTATCATCTCAGATCAAGGGAGG - Intronic
1166847810 19:45740452-45740474 CTATTAAAACAAATGAAGGCCGG + Intronic
1168355761 19:55698636-55698658 GTATAAAAAAAGATCAAGGCAGG - Intronic
929344563 2:40865234-40865256 CTAAAAACACCTATCAAAGCTGG - Intergenic
930186187 2:48414481-48414503 CTATAAACACAGATTAATACAGG - Intergenic
930783196 2:55244376-55244398 CTATAAAAACATTTCAAAGCTGG + Intronic
933936364 2:87207057-87207079 GTACAAACACAGATCATTGCAGG - Intergenic
936760666 2:115777031-115777053 CTATAAACACAGATCAAGGCAGG - Intronic
938973949 2:136457919-136457941 CTATAAAGAAATATCAAGCCAGG + Intergenic
939114769 2:138048109-138048131 CTATATACACAGATAAGGTCTGG - Intergenic
940088535 2:149889950-149889972 ATAAAGACACAGATCAAGTCGGG + Intergenic
941232174 2:162924271-162924293 CTTTATGCTCAGATCAAGGCAGG - Intergenic
946484101 2:220084514-220084536 CTGGAAACACAAATCCAGGCTGG + Intergenic
946613782 2:221487333-221487355 CTGTAAAAACAGGACAAGGCAGG - Intronic
947121574 2:226820849-226820871 CTATTAACACAGATCAAAAAGGG + Intergenic
947707890 2:232291532-232291554 GTTCAAACACAGGTCAAGGCCGG - Intronic
948199841 2:236121593-236121615 CAAAAAAGTCAGATCAAGGCTGG - Intronic
948558445 2:238834445-238834467 ATATAAAAACATATCAAAGCAGG - Intergenic
1170310702 20:14988404-14988426 CCATAAACACAGGGCAAGGAGGG - Intronic
1171147219 20:22795463-22795485 GTATAGAGACAGAGCAAGGCTGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175338537 20:58212623-58212645 CTGTACATACAGATCAAGTCAGG + Intergenic
1175386575 20:58599812-58599834 CTAAAAACACAGATTAGGGCCGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1175807096 20:61835726-61835748 CTATAAACAGAGCCCAAGACAGG - Intronic
1177200885 21:17954588-17954610 GTATAAACACAGTCCAATGCAGG - Intronic
1181106369 22:20578219-20578241 TTAAAAACACAGTACAAGGCTGG - Intronic
950871306 3:16231927-16231949 CTCTAGGCACAGATCAAGGGTGG + Intronic
951201546 3:19880729-19880751 TTATTAAAACAGATGAAGGCGGG + Intronic
951397317 3:22184958-22184980 CTAAAAACTCAGGACAAGGCAGG - Intronic
951533420 3:23719748-23719770 CTTTTAAAAAAGATCAAGGCCGG - Intergenic
952188720 3:30999185-30999207 CTAGAAACACAGACTAAGACAGG - Intergenic
954181598 3:48885507-48885529 CAAGAAAAACAGAACAAGGCTGG + Intronic
954469231 3:50677579-50677601 CTATAATCACATAGCAAGGAGGG + Intronic
959329286 3:104981953-104981975 CTTTAAAAACAAAACAAGGCCGG - Intergenic
959685156 3:109137316-109137338 CTTTAAAGGCAGATCAAGGAAGG + Intergenic
960468561 3:118030387-118030409 CAATAAACACAAAAGAAGGCAGG - Intergenic
960608250 3:119530465-119530487 CTGGAAACACAGAACAAGTCTGG + Intronic
963873942 3:150452147-150452169 TTAAAAATAGAGATCAAGGCTGG + Intronic
976841887 4:89441477-89441499 CTTTAAGAATAGATCAAGGCCGG - Intergenic
977036375 4:91958589-91958611 CTCTATACACAAATCAAGGAAGG - Intergenic
977135651 4:93300484-93300506 ACCTCAACACAGATCAAGGCTGG - Intronic
979383012 4:120030814-120030836 CTATAAACACAGGGCCAAGCTGG + Intergenic
979799586 4:124892135-124892157 GTATAATCCCAGACCAAGGCAGG + Intergenic
981069153 4:140516720-140516742 CCATCAACACAGGTAAAGGCAGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982641917 4:157972357-157972379 ATATAACCACAAAGCAAGGCTGG - Intergenic
982844660 4:160234639-160234661 CTAAATAAACAGATCAGGGCTGG - Intergenic
984222398 4:176994281-176994303 CCATAACCACAGATCTATGCAGG + Intergenic
985929804 5:3048089-3048111 GTTTAAACACAGAACTAGGCAGG - Intergenic
986118421 5:4804239-4804261 CTATACATACAGATAAAGACAGG - Intergenic
990101660 5:52197769-52197791 CTATAGACATAGATCCAGACTGG - Intergenic
992734899 5:79709085-79709107 CTACAAACAGGTATCAAGGCAGG + Intronic
993342041 5:86736701-86736723 CTATAAACACACATATAGGATGG - Intergenic
1000964384 5:167638069-167638091 CTATAAAGACAGAACAGGGCAGG + Intronic
1001287672 5:170435634-170435656 CCATAATCACATAACAAGGCAGG - Intronic
1003130623 6:3392421-3392443 CTATATAGACAGATCGATGCAGG + Intronic
1003366883 6:5483419-5483441 CTATAATCCCAGGCCAAGGCAGG + Intronic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004884620 6:20039652-20039674 CTATAAAAACAGAATGAGGCCGG + Intergenic
1004893421 6:20123758-20123780 CAAAAAAGCCAGATCAAGGCTGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005080405 6:21951666-21951688 CTATAAACACAGAACAAAGGTGG - Intergenic
1005268609 6:24139637-24139659 CTCAAAACAGAGATCCAGGCTGG + Intronic
1005428004 6:25724125-25724147 CTATAAGAAGAAATCAAGGCTGG + Intergenic
1006073340 6:31512880-31512902 CTAAAAACACAGAACTAGCCGGG + Intergenic
1009985817 6:70779856-70779878 CTACAAACACAGATCAACATTGG + Intronic
1010164359 6:72897957-72897979 CTACCAAAACAGACCAAGGCAGG + Intronic
1010873822 6:81076069-81076091 CTAAAAACACAACACAAGGCAGG + Intergenic
1015599140 6:134895460-134895482 ATGTAATCACAGACCAAGGCTGG + Intergenic
1018000692 6:159576119-159576141 TTATAAAGACACATCATGGCTGG - Intergenic
1018706481 6:166467438-166467460 ATATGAAAACAGAGCAAGGCCGG + Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1021797053 7:24266358-24266380 CTATTAACAAAGAAGAAGGCAGG + Intergenic
1023097309 7:36674240-36674262 CTAAAAACACAGTTTAATGCTGG + Intronic
1023893097 7:44407859-44407881 GTAGAAACACAGATCAATTCAGG + Intronic
1023901525 7:44484669-44484691 CTCTAAACACAGATAAAGTTAGG + Intronic
1025238991 7:57256119-57256141 CTAAAAACACAAACCATGGCTGG + Intergenic
1026321606 7:69273267-69273289 CTATAAACACAGTGCTAGACAGG + Intergenic
1027647157 7:80816242-80816264 CTATGAACACAGACCAATGAAGG + Intronic
1027739612 7:81984379-81984401 CTATGAGCACATAGCAAGGCAGG + Intronic
1028329709 7:89575116-89575138 ATATAAACAAAGATCAGTGCTGG - Intergenic
1028607845 7:92674371-92674393 ATATAAACATAGATTAAGGCAGG - Intronic
1030817389 7:114054437-114054459 ATATTATCACACATCAAGGCTGG + Intronic
1033319349 7:140325890-140325912 CTCTAAACTCAGTTCAAAGCTGG + Intronic
1034662964 7:152788250-152788272 CTATAAATAATAATCAAGGCCGG - Intronic
1039625572 8:39048165-39048187 CTGTAATCCCAGACCAAGGCGGG - Intronic
1042145963 8:65730629-65730651 CTAAAAACAGAGAACTAGGCTGG + Intronic
1042413293 8:68490044-68490066 CTAGAAAAGCAGAACAAGGCCGG - Intronic
1045472049 8:102521243-102521265 CTGTATACACACATTAAGGCTGG - Intergenic
1047458117 8:125034894-125034916 CTTCAAACACAGACCAAGCCAGG + Intronic
1047894837 8:129355086-129355108 CTATAAACAGAGATTAAGAGAGG + Intergenic
1048558969 8:135511852-135511874 TTATAAACACAGAGCAGGGCTGG - Intronic
1049448438 8:142643064-142643086 TAATAAACACAAATCATGGCAGG + Intergenic
1051450943 9:17196318-17196340 ATATAAACTCTGATCTAGGCCGG - Intronic
1051754832 9:20387912-20387934 CTATAAACAGAAATACAGGCAGG + Intronic
1055689686 9:78816141-78816163 CTAAAAATACAGATTTAGGCGGG + Intergenic
1057109011 9:92449144-92449166 CTAAAAAAACAGATACAGGCTGG + Intronic
1057986014 9:99714956-99714978 GTATAAACCCACATAAAGGCTGG - Intergenic
1058894878 9:109390883-109390905 TTAGAAACACAGAACAAGTCTGG + Intronic
1058935439 9:109765675-109765697 TGAGAAGCACAGATCAAGGCTGG - Intronic
1059700253 9:116769018-116769040 CTATAAAGAAAGACCCAGGCTGG + Intronic
1060232845 9:121838420-121838442 TTAGAAACACAAATCAGGGCTGG + Intronic
1060343730 9:122799051-122799073 CTTAAAACACAAAACAAGGCCGG - Intronic
1061106978 9:128538498-128538520 CTAAAAATACAAATAAAGGCCGG + Intronic
1061247399 9:129407695-129407717 TTAAAAACACAAATCAAGCCGGG + Intergenic
1185568973 X:1117918-1117940 ATTTAAACACGAATCAAGGCGGG - Intergenic
1187590270 X:20709971-20709993 CTAGAAGCACAGCCCAAGGCAGG - Intergenic
1189220056 X:39363832-39363854 AGATAAACACAGATCATGGATGG - Intergenic
1190027125 X:46934729-46934751 TTATAAACATAGAAGAAGGCCGG - Intronic
1190789018 X:53682742-53682764 CCAGAAACTCAGAGCAAGGCAGG + Intronic
1192896711 X:75450630-75450652 TTTTAAACACATATCAAAGCTGG - Intronic
1196814094 X:119651375-119651397 CTATAAACATATATCAGGCCAGG + Intronic
1197131856 X:123014724-123014746 CTATAAAAAATGAACAAGGCCGG + Intergenic
1198020945 X:132657295-132657317 CTAAAAACACACACCAAGTCTGG - Intronic
1200176472 X:154120563-154120585 CTATAACCACAGATGCAGACAGG - Intergenic