ID: 936763521

View in Genome Browser
Species Human (GRCh38)
Location 2:115816068-115816090
Sequence TTAATTCAGTAACTATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1214
Summary {0: 1, 1: 2, 2: 23, 3: 187, 4: 1001}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936763520_936763521 23 Left 936763520 2:115816022-115816044 CCTTTAAAAAATAACATAATTAG 0: 1
1: 0
2: 5
3: 133
4: 1504
Right 936763521 2:115816068-115816090 TTAATTCAGTAACTATTTATTGG 0: 1
1: 2
2: 23
3: 187
4: 1001

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936763521 Original CRISPR TTAATTCAGTAACTATTTAT TGG Intronic
900734940 1:4293611-4293633 TTAACTCATCAACTATTTATTGG - Intergenic
901442693 1:9288248-9288270 TTCATTCAGCAAGCATTTATTGG - Intergenic
901578193 1:10217967-10217989 TTTATTCAATAGCTATTTACTGG - Intronic
901690411 1:10969592-10969614 TTCATTCAACAAATATTTATTGG + Intronic
901943412 1:12681559-12681581 TTTATTCAGTAAACATTGATGGG + Intergenic
902352031 1:15863525-15863547 TTATATTAGAAACTATTTATTGG - Intronic
902371233 1:16008339-16008361 TTTATTCACCAAGTATTTATTGG + Exonic
902463047 1:16593778-16593800 ATTATTCAGTAATTATTCATAGG + Intronic
902758529 1:18565653-18565675 TTCACTCAGTTATTATTTATAGG - Intergenic
902798881 1:18817315-18817337 TCAATTCACTAAGCATTTATTGG + Intergenic
902819630 1:18936089-18936111 TTAATCCAGTGAATATTTATGGG - Intronic
903158471 1:21466949-21466971 ATTATTCAGTAATTATTCATAGG - Intronic
903491665 1:23733454-23733476 TTCATTCAATAAAGATTTATTGG + Intergenic
903988245 1:27245319-27245341 TTCATTCAGCAAATATTTATTGG + Intronic
904192634 1:28758878-28758900 TTAAATCAGTTACCATTTTTTGG - Intronic
904252565 1:29235718-29235740 TTCATTCAACAAATATTTATTGG - Intergenic
904268694 1:29333900-29333922 ATAATTCAGGGAATATTTATGGG + Intergenic
904574778 1:31498281-31498303 AGAATTCAGTAAATATTTGTAGG - Intergenic
904799887 1:33085115-33085137 TTGATTCAGCAAATATTAATTGG + Intronic
905409375 1:37757730-37757752 TTCATTCAGCAAATATTTTTTGG + Intronic
905483744 1:38280877-38280899 TTGATTCAACAACTATTTATGGG + Intergenic
906014933 1:42567829-42567851 TTAATCCAATAAATATTTATAGG - Intronic
906091428 1:43182746-43182768 TAGATTCAGCAACCATTTATTGG + Intronic
906098424 1:43239997-43240019 TCAATTCAATACATATTTATTGG - Intronic
906332480 1:44898451-44898473 TTTATTCAACAACTATTTATTGG - Intronic
906806543 1:48784317-48784339 TTGATTCAGTAAAAATATATTGG - Intronic
907660713 1:56390207-56390229 TTTATTCAACAAATATTTATTGG - Intergenic
908192804 1:61720733-61720755 TTTATTGAGAAAGTATTTATTGG - Intronic
908635359 1:66157785-66157807 TTCATTCAATATCTATTTGTTGG - Intronic
908637105 1:66179606-66179628 ATCATTCAGCAACTATTGATTGG - Intronic
908909705 1:69059011-69059033 TGAATTCAGTAATTATTTTCGGG - Intergenic
909247631 1:73307866-73307888 CTAAGTCAGAAACTGTTTATAGG + Intergenic
909267739 1:73582588-73582610 TTCATTCAATAGATATTTATTGG - Intergenic
909361032 1:74758910-74758932 TTAATTCAATAAACATTTCTTGG - Intronic
909475981 1:76081429-76081451 CCAATTTAGTAAATATTTATAGG + Intronic
909548585 1:76874194-76874216 TTTGTTCAGTAATTATTCATTGG - Intronic
909586223 1:77291660-77291682 CTAATTCAACAAATATTTATTGG + Intronic
909772317 1:79439570-79439592 TTTATTCAGCAAATATTTATTGG - Intergenic
909799301 1:79785571-79785593 TTAATTCAGTGCCTCTTTCTGGG - Intergenic
909939923 1:81599332-81599354 TAAATTCAGCAAACATTTATTGG - Intronic
910038238 1:82814748-82814770 TTGATTCAGTAAATATTTATTGG - Intergenic
910149282 1:84122669-84122691 TTAATTCACTAACAATTTAATGG - Intronic
910152483 1:84167675-84167697 TTAATTCTATAAGTATTTATTGG - Intronic
910239775 1:85074011-85074033 CTAACTCAATAAATATTTATTGG - Intronic
910389853 1:86730161-86730183 TTGATTCAGTAAATATGTATTGG + Intronic
910472239 1:87567088-87567110 TTAATTCCATAAATATTTACTGG + Intergenic
910648857 1:89542484-89542506 GTCATTCAGTAAATATTTAGTGG - Intronic
910748047 1:90595204-90595226 TTAATTTTGTAACTAGTTATTGG - Intergenic
911168769 1:94748181-94748203 TTCATTCAATAAATATTTGTGGG - Intergenic
911284039 1:95968276-95968298 TTAATTTAATAACTACATATTGG + Intergenic
911346923 1:96708223-96708245 TTCATTCCATAATTATTTATTGG + Intergenic
911364713 1:96923455-96923477 TTCATTCAGTAATTACATATGGG - Intergenic
911378538 1:97082470-97082492 GTAATTCAGTGGCTATTTTTAGG - Exonic
911542848 1:99179279-99179301 TTAATTTTGTAAATATTTATGGG + Intergenic
911550998 1:99280468-99280490 TAAATTCAGTGAACATTTATTGG + Intronic
911639192 1:100268693-100268715 TTAATTCAATGAATATTTATTGG - Intronic
911682324 1:100731684-100731706 TTAAAATAGTAACTATTTACTGG + Intronic
911695075 1:100881756-100881778 TTAATTCATTAGTTCTTTATAGG + Intronic
911710489 1:101066185-101066207 TTCACTCAATAAATATTTATGGG + Intergenic
911884534 1:103280937-103280959 TTCATTCAGTGACTTTCTATAGG + Intergenic
912189014 1:107315865-107315887 TTCATTCAATAAATAGTTATTGG - Intronic
912311879 1:108631141-108631163 TAAATTCAGTAACTGTTTCTTGG + Intronic
912529926 1:110312848-110312870 TTAATTCAGCAAATATTTACAGG - Intergenic
912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG + Intergenic
913119814 1:115729432-115729454 TTTATTCAGTAAGTATTTAGTGG + Intronic
913367449 1:118056349-118056371 TTAATCCAGTGAGTATTAATTGG - Intronic
913506299 1:119518994-119519016 TTTATTTAATAAATATTTATGGG - Intergenic
913543739 1:119846215-119846237 ATTATTCAGTAATTATTCATAGG + Intergenic
913640027 1:120803816-120803838 ATTATTCAGTAATTATTCATAGG - Intergenic
913709037 1:121461739-121461761 TTTATTCAGCAAGTACTTATTGG - Intergenic
914212468 1:145592700-145592722 ATTATTCAGTAATTATTCATAGG + Intergenic
914278452 1:146146522-146146544 ATTATTCAGTAATTATTCATAGG + Intronic
914539499 1:148597470-148597492 ATTATTCAGTAATTATTCATAGG + Intronic
914627182 1:149474158-149474180 ATTATTCAGTAATTATTCATAGG - Intergenic
914731846 1:150378675-150378697 TTAATTAAGAAATAATTTATTGG + Intronic
914869491 1:151460948-151460970 TTCATTCAATGAATATTTATTGG + Intergenic
914934150 1:151963314-151963336 TTCATTCAATAAGTATTTATTGG + Intergenic
914940291 1:152016853-152016875 ATTATTCAGTAATTATTCATAGG - Intergenic
914959109 1:152190241-152190263 TTCATTCAACAAATATTTATTGG + Intergenic
915059418 1:153168450-153168472 TTAATTCTGTACCTATATTTTGG + Intergenic
915496125 1:156283995-156284017 TTCATTCAGTAAATACTTACTGG - Intronic
915620270 1:157078298-157078320 TTAATTCAACAAGTATTTATGGG - Intergenic
915794813 1:158718079-158718101 TAAATTCAGTCACTGTTGATTGG + Exonic
915989608 1:160500745-160500767 TTCACTCAGTAAATATTCATGGG - Intronic
916117563 1:161500248-161500270 TTCATTCAGCAAGTATCTATTGG - Intergenic
916287259 1:163121903-163121925 TTAATTGACAAACAATTTATGGG - Intronic
916545110 1:165796765-165796787 TTAATTCAACAAGTATGTATGGG + Intronic
916613629 1:166417436-166417458 TTAAAGCATTAAATATTTATGGG - Intergenic
916621862 1:166506702-166506724 TAAATTCAGTATCTTTTTGTAGG - Intergenic
916626669 1:166565499-166565521 TTAATTTAATAAATATTTATTGG - Intergenic
916649588 1:166822480-166822502 TTACCTCAGTATCTATTTCTTGG + Intergenic
916659791 1:166912334-166912356 TTACTTCAGTAATGATTTGTTGG - Exonic
916778475 1:167995822-167995844 TTAACTCACCAAATATTTATTGG + Intronic
916843299 1:168622794-168622816 TTAATTCTATAAATATTTGTTGG - Intergenic
916945461 1:169721830-169721852 TTCATTCAATAAATATTTGTTGG + Intronic
917926387 1:179792504-179792526 ATAATCAAGTCACTATTTATTGG - Intronic
918098097 1:181350818-181350840 TTAATTGAGCAAGTATTTGTTGG + Intergenic
918419331 1:184347634-184347656 TTAATTCATTAAATAATTTTTGG + Intergenic
918618010 1:186570489-186570511 TTATTTCACTAATTATTTGTAGG + Intergenic
918678579 1:187322178-187322200 TTCATTCAGCAAATATTTACTGG - Intergenic
919047086 1:192465895-192465917 TTAATTCAACAAATATTTGTTGG + Intergenic
919214920 1:194540863-194540885 TTTATTCAAGAAATATTTATTGG - Intergenic
919408424 1:197213380-197213402 TCTAATCAGTAACTATTTTTAGG - Intergenic
919461028 1:197877435-197877457 TTAATCTACTAACTAGTTATAGG + Intergenic
919516977 1:198537817-198537839 TTAATTCAATAAGTGTTTATTGG - Intronic
919694970 1:200565014-200565036 TTCATTTAATAATTATTTATTGG - Intronic
919733652 1:200930593-200930615 TTAATTCAGTAAAGATGTATTGG + Intergenic
920058693 1:203212829-203212851 TTCATTCAGTAACTATTTATTGG + Intronic
920143044 1:203833723-203833745 TGTATTCAGTAACTACTAATGGG - Intronic
920353703 1:205354737-205354759 TTCATTCAGTAAATATTCCTTGG - Intronic
920895666 1:210047270-210047292 TTAATTCAATAAACATTTATTGG - Intronic
921029978 1:211327910-211327932 TTAATTCTGTAAATATTTATTGG + Intronic
921082240 1:211750927-211750949 ATAATTTAGCAACTATTTAAAGG + Intronic
921454233 1:215348424-215348446 TTAACTCAGTAAATATTACTTGG + Intergenic
921498569 1:215871596-215871618 TTCATTCATTTAATATTTATTGG + Intronic
921510703 1:216024671-216024693 TTAATTCCATAAGTATTTGTTGG + Intronic
921600730 1:217103657-217103679 TTAATTAATTAATTATTTTTTGG - Intronic
921869483 1:220123955-220123977 TTAACTCAGTTAATATTCATAGG + Intronic
921896877 1:220411046-220411068 TAAATTCAGAAACTCTATATTGG + Intergenic
921950602 1:220926236-220926258 TTAATTCAGCAAAGATTTACTGG - Intergenic
922112208 1:222571491-222571513 TTAGTTCAGTAAATTTTTAGTGG - Intronic
922112691 1:222577137-222577159 TTGATTCAGTAACTACTGACAGG - Intronic
922283829 1:224151067-224151089 GTAGTTCAGTAAGTTTTTATTGG + Intronic
922409845 1:225362016-225362038 TTCATCCAAAAACTATTTATAGG + Intronic
922920602 1:229299649-229299671 TTACTAAAGTAACTATATATGGG + Intronic
923452953 1:234136963-234136985 TTCATTCTGCAAATATTTATTGG + Intronic
923455210 1:234159588-234159610 TTACTTCAGTACTTTTTTATTGG - Intronic
924091725 1:240508232-240508254 TTCATTCAATAAATATGTATTGG - Intronic
924278926 1:242416894-242416916 TCCATTCAGTAAACATTTATTGG + Intronic
924662255 1:246031863-246031885 TTAATTCAGAAACAATATTTAGG + Intronic
924838159 1:247676489-247676511 TTTATTCATTAAATATTTAAAGG + Intergenic
1063837033 10:10027159-10027181 TTAATTCAGCAAATATTTGTTGG + Intergenic
1065057867 10:21865327-21865349 TTAATTCATTCACTATTTCATGG - Intronic
1065152094 10:22832300-22832322 TCAATTCAGGAAATATTTATTGG + Intergenic
1065770886 10:29077334-29077356 CTAATTCAGCAAGTATTTATTGG - Intergenic
1066123642 10:32317244-32317266 TTTATTAAATAAGTATTTATTGG - Intronic
1066751082 10:38658134-38658156 CTGATTCAGTTACTAGTTATAGG - Intergenic
1066965963 10:42264958-42264980 CTGATTCAGTTACTAGTTATAGG + Intergenic
1068026191 10:51648132-51648154 ATTATTCAATAAATATTTATGGG + Intronic
1068882700 10:62066992-62067014 TTAATTCACCAAAAATTTATTGG - Intronic
1069444179 10:68457663-68457685 TTCATTTAGCAAATATTTATTGG - Intronic
1069498050 10:68924833-68924855 TTAATTTAGAAAGTTTTTATAGG + Intronic
1069534632 10:69243914-69243936 CTAATTCAGTCAGTATTTGTGGG + Intronic
1071117139 10:82234575-82234597 TTCATTCAACAATTATTTATTGG - Intronic
1071668353 10:87582806-87582828 TTTGTTCAGTAAATATTTATAGG - Intergenic
1072005618 10:91243955-91243977 TTCATTCAGCAAATATTTACTGG + Intronic
1072473725 10:95738124-95738146 TTTATTCAATAAATATTTACTGG - Intronic
1072794281 10:98342558-98342580 TCAATTCAACAAATATTTATTGG - Intergenic
1072844587 10:98815705-98815727 TTCTTTCAGTAAATATTTACTGG - Intronic
1073390802 10:103174999-103175021 TTAATTTAGTAACTTAATATTGG + Intronic
1073551625 10:104407688-104407710 TTAATTAATTAATTAATTATGGG - Intronic
1073649958 10:105347827-105347849 TTGATTCAATAAATAATTATTGG - Intergenic
1073785802 10:106888507-106888529 TTCATTCAAGAAATATTTATTGG - Intronic
1073940493 10:108692485-108692507 ATAATTGAGTTACTAGTTATTGG - Intergenic
1073963499 10:108961267-108961289 TCAGTTTAGTAAGTATTTATTGG + Intergenic
1074007619 10:109444108-109444130 TTAGTTAAGTAACTTTTTCTGGG - Intergenic
1074404852 10:113172081-113172103 TTCATTCAGTGACTATTTCTTGG + Intergenic
1074726717 10:116318358-116318380 TGTATTCAATAAATATTTATTGG - Intergenic
1074852184 10:117447819-117447841 TTCATTCAGCAACTATTTTAAGG - Intergenic
1075277993 10:121112730-121112752 TTAATTCAACAAATATTTACTGG + Intergenic
1075283596 10:121162934-121162956 ATCATTCAGTAATTATGTATTGG - Intergenic
1075380066 10:122011801-122011823 TTAATTGAACAAATATTTATTGG + Intronic
1075522582 10:123152015-123152037 TTACATCAGTAAATATTTACTGG + Intergenic
1075953029 10:126498375-126498397 TTCATTCAGCAAATATATATTGG - Intronic
1077203229 11:1324774-1324796 TGAATTCATCAAATATTTATTGG - Intergenic
1077794384 11:5476495-5476517 TTCATCCAGTGACTATTTTTTGG - Intronic
1077879419 11:6336854-6336876 TTAAATCAGTAAATTTGTATCGG - Intergenic
1078114371 11:8430771-8430793 ATAATTCAACAAATATTTATTGG - Intronic
1078128299 11:8590361-8590383 TTCATTCAATAAATATTTATGGG - Intronic
1078486705 11:11729854-11729876 TTCATTCCATAAATATTTATTGG - Intergenic
1078654695 11:13227483-13227505 TTTACTCAGTACATATTTATTGG + Intergenic
1078785159 11:14483762-14483784 CTCATTCAGTATTTATTTATTGG - Intronic
1078819188 11:14859752-14859774 TTCATTCAACAAGTATTTATTGG + Intronic
1078858411 11:15225408-15225430 TTCATTCAATAAATACTTATTGG + Intronic
1078945346 11:16060956-16060978 TTAAATCAGAAACTATTGATTGG - Intronic
1079053045 11:17180090-17180112 TTTCCTCAGTAAATATTTATTGG + Intronic
1079471277 11:20780446-20780468 TTAATTCAGTAAACCTTTATTGG + Intronic
1079827727 11:25219096-25219118 TACATTCAGTAAACATTTATTGG - Intergenic
1079942607 11:26700370-26700392 TCCATTCAGAAAGTATTTATTGG + Intronic
1080038456 11:27733626-27733648 TCAATTCAACAACTACTTATTGG - Intergenic
1080050795 11:27856932-27856954 TTCATTCAACAAATATTTATTGG - Intergenic
1080072333 11:28104762-28104784 TTTATTCAACAAGTATTTATTGG - Intronic
1080074002 11:28126478-28126500 TTATTTCAACAAATATTTATGGG - Intronic
1080262265 11:30362125-30362147 CTCATTCAGTTAGTATTTATTGG - Intergenic
1080487118 11:32720640-32720662 TAAATTCACTTACTATTTTTGGG - Intronic
1081028802 11:38051204-38051226 TTAATACAATAACAATTTAGTGG - Intergenic
1081034571 11:38126940-38126962 TTCATTCAATACATATTTATGGG + Intergenic
1081112558 11:39154388-39154410 TACTTTCATTAACTATTTATAGG + Intergenic
1081270109 11:41072906-41072928 TTATTTCAGGAATTTTTTATTGG + Intronic
1081287414 11:41288034-41288056 GTTATTCAAGAACTATTTATTGG + Intronic
1081642952 11:44770066-44770088 TTTATTCAGCAAATATTTGTTGG + Intronic
1082113928 11:48307305-48307327 TTTATTCATTAAATATTTATTGG + Intergenic
1082227069 11:49720575-49720597 TTCATTCAGAAAATATTTATTGG - Intergenic
1082569267 11:54717913-54717935 TAAGTTCACTAAATATTTATTGG + Intergenic
1083360898 11:62107157-62107179 TTTATTAAGTAAATATGTATGGG - Intergenic
1083982974 11:66189401-66189423 TTTATTCAACAAATATTTATTGG + Intronic
1084131703 11:67140820-67140842 TTAATTCACCAGTTATTTATTGG + Intronic
1085069132 11:73526232-73526254 TTAATTTTTTAAATATTTATTGG - Intronic
1085208873 11:74756119-74756141 TTAATTTAGTAACCATTTGAGGG + Intronic
1085233407 11:74992417-74992439 TTGATTCAATAAATATTTCTAGG - Intronic
1085565166 11:77507032-77507054 GTCATTCAACAACTATTTATGGG - Intergenic
1085983544 11:81755487-81755509 TTTATTCAGCAAATATTTCTTGG + Intergenic
1086005987 11:82036450-82036472 TCAATTCGGCAAATATTTATTGG - Intergenic
1086263526 11:84970377-84970399 TTCATTCAGTACATTTTTATTGG + Intronic
1086273636 11:85097443-85097465 TTAATTCAATATATATTTACAGG - Intronic
1086343731 11:85874148-85874170 TTCATTCAGTACATATTTAGTGG + Intronic
1086487094 11:87317785-87317807 TTTATTCAGTAAACATTTAATGG - Intronic
1086517436 11:87629079-87629101 TTCATTCAGTAAATATTTACTGG - Intergenic
1086598970 11:88608884-88608906 TTCATTCACCAAATATTTATTGG - Intronic
1086622357 11:88902511-88902533 TTCATTCAGAAAATATTTATTGG + Intronic
1087228894 11:95637241-95637263 TTTATTCACTTATTATTTATGGG + Intergenic
1087240053 11:95764544-95764566 TTAATTCTGTAAATATTAAGAGG - Intergenic
1087294471 11:96354552-96354574 ATAGTTCAGCAACTAGTTATGGG + Intronic
1087544146 11:99562712-99562734 GTAATTGATTAAATATTTATTGG + Intronic
1087748811 11:101982246-101982268 TTAATTCAATAAATATTTACTGG - Intronic
1087884555 11:103463436-103463458 TTTATTCAGTCTCTTTTTATTGG - Intronic
1087904476 11:103679842-103679864 TTAATTAATCAAATATTTATTGG + Intergenic
1087961163 11:104351364-104351386 GTAATTCAGTAAATATATATTGG - Intergenic
1088451974 11:109991699-109991721 TTCATTCAATAAATATTTATTGG + Intergenic
1088562925 11:111134191-111134213 TTTATTCTGTCAATATTTATTGG + Intergenic
1089018270 11:115185318-115185340 TCAACTCAGTAAGTGTTTATTGG - Intronic
1089064842 11:115654730-115654752 TTTATTCAGAAAATATTTATTGG - Intergenic
1089256613 11:117197599-117197621 TTAATTCAGTAAACATTTACCGG + Intergenic
1089316897 11:117598026-117598048 TTAAAGAAGTAAATATTTATTGG + Intronic
1089546779 11:119233203-119233225 TTAATTCAATAAATATTTGAAGG + Intronic
1089754019 11:120673259-120673281 TTCATTCAGTAGATATTTAGTGG - Intronic
1089866263 11:121634825-121634847 TTCATTCATTCAGTATTTATTGG - Intergenic
1089977515 11:122745351-122745373 TTCATTCAGCAAGTATTTATGGG + Intronic
1090265833 11:125352278-125352300 TGAATTCAATAATTATTTATTGG + Intronic
1090441051 11:126725982-126726004 TTCATTCAAGAAGTATTTATGGG - Intronic
1090642640 11:128742335-128742357 TTAATTTAGCAAATATTTATTGG - Intronic
1090813563 11:130269283-130269305 TTAATTAATTAATTATTTAGTGG - Intronic
1091109877 11:132955983-132956005 TTAATTGAATAAATATTGATTGG - Intronic
1092049587 12:5458524-5458546 TTCATTCATCAACTTTTTATTGG - Intronic
1092065341 12:5585592-5585614 TTATTTCAGTAAATATTTACTGG - Intronic
1092098715 12:5865197-5865219 TCAATTCAACAAGTATTTATTGG + Intronic
1092140234 12:6178728-6178750 TTGATTCAATAAATATTTATGGG - Intergenic
1093221549 12:16426527-16426549 AACATTCAGTAAATATTTATTGG - Intronic
1093339846 12:17960517-17960539 TTTATTTAGTAACAATATATTGG - Intergenic
1093378837 12:18465372-18465394 TTTATTTAGTAAATATTTATAGG + Intronic
1093515139 12:19976722-19976744 TTATTTCAATAAATATGTATTGG - Intergenic
1093530607 12:20157826-20157848 TTCATTCAACAAATATTTATTGG - Intergenic
1093821252 12:23620853-23620875 TTCATTTAATAAATATTTATTGG + Intronic
1094307269 12:29034748-29034770 TTAATTCAATAAATATTCACTGG + Intergenic
1094317896 12:29152136-29152158 TTAATTCAATAACTACCTTTGGG - Intronic
1094386625 12:29901372-29901394 ATTATTCAGCAAATATTTATTGG - Intergenic
1095239086 12:39835729-39835751 TTAATTCAATAAATATATATTGG - Intronic
1095486877 12:42694589-42694611 TTAATTCATTTGGTATTTATTGG + Intergenic
1095501480 12:42844479-42844501 ATAATTAAGTAATTATTGATAGG + Intergenic
1095522126 12:43079102-43079124 ATGATTCATCAACTATTTATTGG + Intergenic
1095774222 12:45994489-45994511 TTATTTCAGCAACAATTAATTGG + Intergenic
1095939010 12:47713524-47713546 TTAATTCAATGATTATCTATGGG + Intronic
1096243347 12:49971194-49971216 TTCATTCAACAAATATTTATTGG + Intronic
1096385595 12:51192950-51192972 ATAATTCAGTCACTATTGTTGGG - Intronic
1096725767 12:53560905-53560927 TTAATTCAGTATCTATACTTGGG + Intronic
1096961536 12:55583202-55583224 TTAATTATTTAAATATTTATTGG + Intergenic
1097307564 12:58086379-58086401 ATAGTTCAGTAAATATTTGTTGG - Intergenic
1097413643 12:59286472-59286494 TTTATTAAGTTACTATTAATTGG - Intergenic
1097414248 12:59295048-59295070 TTTATCCAGAAAATATTTATTGG + Intergenic
1097536825 12:60882641-60882663 TATATTCAGTAACTATTTGAAGG - Intergenic
1097641160 12:62183733-62183755 TTTATTCAATAAGTATTTATTGG - Intronic
1097813379 12:64043894-64043916 TTAATTCAAAATATATTTATTGG + Intronic
1097867685 12:64572642-64572664 TTAATTTAGTAAATATTTATTGG - Intergenic
1097913667 12:64997450-64997472 CTTATTCAATAAATATTTATTGG - Intergenic
1098027992 12:66225599-66225621 TTAATTCAAAAATTACTTATGGG - Intronic
1098624321 12:72644083-72644105 ATGATTCAGCAACAATTTATGGG + Intronic
1098741795 12:74181458-74181480 ATAATTCAATAAGTATTTAATGG - Intergenic
1098935742 12:76477275-76477297 TTAATTCAGAAAATATTACTAGG - Intronic
1099085897 12:78245537-78245559 TGAATTCAGTAAGAATCTATTGG - Intergenic
1099474654 12:83093780-83093802 TTCAATCAGTAAATACTTATTGG + Intronic
1099645600 12:85350707-85350729 TTAATTCAGAAACTATAGTTAGG - Intergenic
1099694811 12:86004922-86004944 TTAATTCAGTCCCTGTTTCTTGG - Intronic
1099791501 12:87340894-87340916 TTAATTCAGTATTTATTGCTGGG - Intergenic
1099828982 12:87815760-87815782 TTCATTCAATAAATATTTCTTGG - Intergenic
1099908142 12:88796528-88796550 TTATTTGAGTAACGACTTATTGG - Intergenic
1100153177 12:91766424-91766446 TTAATTAAGTAATTACTTAAGGG - Intergenic
1100172364 12:91989834-91989856 TTCATTCAATAAATATGTATTGG + Intronic
1100208453 12:92376548-92376570 TGAATTCAATAAATATTTACTGG + Intergenic
1100270288 12:93018286-93018308 TTAATTAACTAACTAATTTTTGG + Intergenic
1100283109 12:93137601-93137623 TTTATTCAATAAATATTGATTGG - Intergenic
1100288961 12:93195443-93195465 TTCACTCAGTAAATAATTATTGG - Intergenic
1100328519 12:93564742-93564764 TTCATTCAATAACTTTATATTGG + Intergenic
1100420252 12:94425279-94425301 TTAATTCAGTCCCCATTTCTTGG - Intronic
1100574511 12:95877383-95877405 TTATTTCTGTAACTGGTTATAGG - Intronic
1100866030 12:98857713-98857735 ATATTTCAAGAACTATTTATGGG + Intronic
1100885751 12:99068034-99068056 TTAATTCAATAAGAATTTTTAGG + Intronic
1100924640 12:99530839-99530861 TTTATTCAACAAATATTTATTGG - Intronic
1101259046 12:103010505-103010527 TTAATTCAAAAAGTGTTTATTGG - Intergenic
1101604299 12:106236167-106236189 TTCATTCAATAAACATTTATTGG - Intergenic
1101624988 12:106431134-106431156 TTAATTCAGCATATATTCATGGG - Intronic
1101726213 12:107390504-107390526 ATAATTCAGTGAGTATTTTTTGG - Intronic
1101752042 12:107589815-107589837 TTCATTCAACAATTATTTATTGG - Intronic
1101931924 12:109021727-109021749 TTTATTCAACAAATATTTATGGG - Intergenic
1102408334 12:112693941-112693963 TTCAATCAGCAAATATTTATTGG - Intronic
1102420749 12:112800999-112801021 TTAATCCAGCCACTATTCATGGG - Intronic
1102511900 12:113421545-113421567 TTCATTCATTAAATGTTTATTGG - Intronic
1102514673 12:113438254-113438276 TCAATTCAGAAAGTGTTTATTGG - Exonic
1102940898 12:116940697-116940719 TTAATTTATTAAATATTTAAGGG - Intronic
1103054752 12:117809803-117809825 CTCATTCATTAAGTATTTATTGG - Intronic
1103198899 12:119070284-119070306 TTCATTCAATGTCTATTTATTGG + Intronic
1103325876 12:120120203-120120225 TTAATTCAGTAAATATTAAGTGG + Intergenic
1103670271 12:122608696-122608718 TTAATTCAGTATATATCTGTTGG - Intronic
1103778761 12:123385158-123385180 TTCATTCAGTAAATATCTATTGG + Intronic
1105390283 13:19970662-19970684 TTCATTCAGTAAATATTTATTGG + Intronic
1105420349 13:20246828-20246850 TTCATTTAACAACTATTTATTGG + Intergenic
1105458653 13:20564268-20564290 TTAATTCAACAAATATTTCTTGG + Intergenic
1105478021 13:20745974-20745996 TATATTCAGTAAATATTTATTGG - Intronic
1105938010 13:25119740-25119762 ATGATTCAGTAAATATTTGTTGG - Intergenic
1106058261 13:26259784-26259806 TTCATTCAACAAGTATTTATTGG + Intronic
1106143623 13:27033080-27033102 TTTATTCAATAAATATGTATTGG + Intergenic
1106145888 13:27049389-27049411 TTCATTGAATAAATATTTATTGG - Intergenic
1106207653 13:27614734-27614756 TGGGTTCAGTAATTATTTATTGG + Intronic
1106381039 13:29239519-29239541 TAAATTCAGCAAATACTTATTGG + Intronic
1107406267 13:40116788-40116810 GGCATTCAGTAAATATTTATGGG + Intergenic
1107687247 13:42915079-42915101 TTCATTCCGCAAATATTTATTGG - Intronic
1107816265 13:44247262-44247284 TTGGTTCAATAAATATTTATTGG - Intergenic
1107918683 13:45180706-45180728 TTAATTAAATAAATTTTTATTGG - Intronic
1108177050 13:47802806-47802828 TAAATTCAGTTAATATATATTGG + Intergenic
1108290268 13:48953087-48953109 TTATTTCAGTAACGTTTGATGGG + Intergenic
1109246895 13:59965876-59965898 TCCACTCAATAACTATTTATTGG - Intronic
1109603267 13:64660431-64660453 TTAATTTAGTTACTCTTTCTGGG + Intergenic
1109691067 13:65889997-65890019 TTAAATCAATGATTATTTATAGG + Intergenic
1109774192 13:67018658-67018680 TTAATTTAGTAACTCATTATTGG - Intronic
1109956311 13:69571590-69571612 TTCATTCAATATGTATTTATTGG - Intergenic
1110015180 13:70391145-70391167 TTTTTTCAGCAAGTATTTATTGG + Intergenic
1110123353 13:71910288-71910310 TGAATTCAAAAAATATTTATTGG + Intergenic
1110354218 13:74547896-74547918 TTACTTCATTATATATTTATAGG + Intergenic
1110372679 13:74757197-74757219 TTAATTAAGTGACTATTTTTAGG + Intergenic
1110644462 13:77866418-77866440 TTCATTCAGCTAGTATTTATCGG + Intergenic
1110676037 13:78246068-78246090 TAAATTCAGTAAACAATTATTGG + Intergenic
1111037271 13:82692746-82692768 TTAATACAGTAATTATTTTTGGG - Intergenic
1111345751 13:86951025-86951047 TTCATTCAGTACCTATTTTCTGG - Intergenic
1111516667 13:89342118-89342140 TTATTTCATAAACTATTTTTTGG - Intergenic
1111706281 13:91753049-91753071 TTAATTTGATGACTATTTATTGG + Intronic
1111748705 13:92299595-92299617 ATAATTCAGTTAAAATTTATAGG + Intronic
1111918450 13:94385705-94385727 TTAATTCAGCAAGTCTTTATTGG - Intronic
1111954216 13:94739484-94739506 TTAATTCAACAAATATTTCTAGG + Intergenic
1111965639 13:94858860-94858882 TTTATTCAGTAACAATTTATTGG - Intergenic
1111985167 13:95058656-95058678 TTTTTTCAGTAAGTATTTGTTGG - Intronic
1112628622 13:101136033-101136055 TTAATTGTGTAACCATTTTTAGG - Intronic
1112880976 13:104106192-104106214 TTTATTCAGTAACTGTTAGTTGG - Intergenic
1112908806 13:104456490-104456512 TTCATTCAGCAAACATTTATTGG + Intergenic
1112984556 13:105431818-105431840 ATAATTCAGAAACCATTTATCGG + Intergenic
1113646567 13:112001289-112001311 TTAATACAGTAAATATTTATAGG - Intergenic
1114660611 14:24341289-24341311 TCAATTCAACAAATATTTATTGG - Intergenic
1114875428 14:26711438-26711460 TTAATTGAGTAATAAATTATGGG - Intergenic
1115220544 14:31054088-31054110 TTTATTCAGTTAACATTTATTGG + Intronic
1115318351 14:32050570-32050592 TTTATTCAGTAAATATTTACTGG - Intergenic
1115449913 14:33535584-33535606 TTAATTCATTAGGTATTTATTGG - Intronic
1116051323 14:39807043-39807065 TTCATTAAATAAATATTTATGGG + Intergenic
1116072797 14:40070765-40070787 TTAATTCAGTAAGTATTCATTGG + Intergenic
1116228723 14:42187310-42187332 TAAATTAAGTAAATATTCATTGG + Intergenic
1116328589 14:43566892-43566914 TTAATTCAGCATGTAATTATAGG - Intergenic
1116546687 14:46176534-46176556 TTGCTTCAGTATCTATGTATTGG + Intergenic
1116846027 14:49865825-49865847 TTAATTCAATCACTATATTTTGG + Intergenic
1116995571 14:51320269-51320291 TTTATTCAGTAAAAATTTACTGG - Intergenic
1117058908 14:51940696-51940718 TTAAATCAATAAAGATTTATTGG - Intronic
1117190177 14:53281652-53281674 TTCATTCAATAAATATTTACTGG - Intergenic
1117327659 14:54684222-54684244 CTAACTCGGTAAATATTTATTGG - Intronic
1117391089 14:55263632-55263654 TTAATTCAACAGATATTTATTGG + Intergenic
1117478958 14:56124413-56124435 TGCATTCAGCAAATATTTATTGG + Intronic
1117943350 14:60992397-60992419 TTAATTTTGTAAATATTTCTCGG + Intronic
1118017389 14:61674102-61674124 TTGAATCAGTAAACATTTATTGG + Intergenic
1118390809 14:65293777-65293799 TTAATTCAATAAATATCTATAGG + Intergenic
1119341359 14:73881575-73881597 TTAATTTAACAAATATTTATGGG + Intronic
1119373919 14:74172967-74172989 TTCATTCAATACGTATTTATTGG - Intronic
1119493029 14:75053161-75053183 TTTATTCAGTAAACATTTGTAGG - Intergenic
1119515921 14:75248212-75248234 TTCATTCATTAAATATTTATAGG + Intronic
1119528172 14:75339483-75339505 GGAATTCAATAAATATTTATTGG + Intergenic
1120114377 14:80596424-80596446 TTTATTTAGTTTCTATTTATAGG - Intronic
1120117664 14:80638699-80638721 GGAATTCAGTAAATGTTTATTGG + Intronic
1120124474 14:80724902-80724924 TTAACTAAACAACTATTTATTGG + Intronic
1120331935 14:83104284-83104306 TTTATTCAGTAAATAATAATCGG + Intergenic
1120498122 14:85261280-85261302 TTAATTCAGGAGCTGTGTATGGG - Intergenic
1120519629 14:85511437-85511459 TGAATTCAGTGACTATTTGGTGG + Intergenic
1120563183 14:86021884-86021906 TTAATTCAGAAAATATTTATTGG - Intergenic
1120773239 14:88404822-88404844 TTTATTCAGCATATATTTATTGG + Intronic
1120775514 14:88432213-88432235 TTAATTAAGTTACTCTTTTTAGG + Intronic
1120791182 14:88584332-88584354 TTAATTTTGTCACTATTTCTAGG - Intronic
1121665833 14:95671422-95671444 TTTCTTCAATAAATATTTATCGG - Intergenic
1121969905 14:98346392-98346414 TAAATTGAGTAAATGTTTATTGG + Intergenic
1122005829 14:98702847-98702869 TTAATTAATTATTTATTTATTGG - Intergenic
1122259224 14:100502592-100502614 TTAATTCAGCAAGTGTCTATAGG - Intronic
1124576143 15:30910051-30910073 TCCATTCAGCAAATATTTATTGG - Intronic
1124841192 15:33243647-33243669 TTCATTCAATATATATTTATTGG + Intergenic
1125123115 15:36187485-36187507 GTTATTTAGTAACTAGTTATAGG + Intergenic
1125823147 15:42650847-42650869 TTAAATCAAGAAATATTTATTGG - Intronic
1125852212 15:42914735-42914757 TTAATTATTTAACTAATTATAGG + Intronic
1125867585 15:43067599-43067621 TTCATTCAATAAATAATTATAGG + Intronic
1125980576 15:43996647-43996669 TCAATTCAGTAAGAATCTATAGG - Intronic
1126193832 15:45908779-45908801 CTAATTCAGAAATTATTTAAAGG - Intergenic
1126232832 15:46346908-46346930 TTTATTCTGTAAGTATTAATAGG + Intergenic
1126670272 15:51109981-51110003 TTAAGTCAGCAAATAGTTATTGG + Intergenic
1126748508 15:51851480-51851502 TTTATTTAGTAACTTTTGATTGG + Intronic
1126749977 15:51866739-51866761 TTTATTCAGTAAATATTTGGGGG + Intronic
1126815787 15:52451964-52451986 TTTATTCAGTAAGTAATTACTGG - Intronic
1126954966 15:53923327-53923349 TTCATCCAGTAAATAATTATTGG - Intergenic
1127102500 15:55581821-55581843 TTATTTCAGTAACCCTCTATTGG - Intronic
1127303285 15:57678530-57678552 TGATTTCATTAACTTTTTATTGG + Intronic
1127407690 15:58668783-58668805 TAAATTCAACAAGTATTTATTGG - Intronic
1127536412 15:59893895-59893917 TTAATTCAACAACTATTTACAGG + Intergenic
1127732434 15:61813191-61813213 TTCAGTCAATAAATATTTATTGG + Intergenic
1128030546 15:64476225-64476247 TTCATTCCATAAATATTTATTGG + Intronic
1128396519 15:67231609-67231631 TTAATTCAGTAAGAATTTAGAGG - Intronic
1128823819 15:70690262-70690284 TTCATTCAGTCAGTATTTACAGG - Intronic
1128911395 15:71518815-71518837 TTTATTCAGCAAATGTTTATTGG + Intronic
1129364426 15:75045442-75045464 TACATGCAGTAAGTATTTATTGG - Intronic
1129649633 15:77474422-77474444 TTAATTCAGTAAGTGATTCTGGG - Intronic
1129820895 15:78601196-78601218 TTCATTCAACAAATATTTATGGG - Intronic
1130116301 15:81007519-81007541 TTAATTCGGCAAATATTTACTGG + Intronic
1130527342 15:84718629-84718651 TAAATTCAACAAGTATTTATTGG - Intergenic
1131351121 15:91700812-91700834 TAATTTTAGTAAATATTTATTGG - Intergenic
1131854337 15:96577278-96577300 TTCATTCAGAAAATATTTATTGG - Intergenic
1131883316 15:96881797-96881819 TGTATTCAGCAACTATTTATTGG - Intergenic
1133593916 16:7272535-7272557 TTCATTCATCAAATATTTATAGG + Intronic
1133666381 16:7972144-7972166 TTGATTTTGTAATTATTTATTGG - Intergenic
1134751716 16:16630545-16630567 ATAATTCAGTAAGAATATATTGG + Intergenic
1134907627 16:17994425-17994447 TTCATTCAGCAAACATTTATTGG - Intergenic
1134993742 16:18723078-18723100 ATAATTCAGTAAGAATATATTGG - Intergenic
1135078171 16:19411785-19411807 TTCATTCAACAAGTATTTATAGG - Intronic
1135671089 16:24376192-24376214 TTAATTCAGCAACTGTTTATTGG + Intergenic
1135701417 16:24635972-24635994 TTAATTCATTACATATTTATTGG + Intergenic
1135904087 16:26494516-26494538 TTAATTCAATAAATATTAGTTGG + Intergenic
1136171281 16:28491359-28491381 TGGATTCAGTAAATATTTGTGGG + Intronic
1136188107 16:28599983-28600005 TTATTTTATTAACTATTTCTTGG + Intergenic
1136190579 16:28612977-28612999 TTATTTTATTAACTATTTCTTGG + Intronic
1136663085 16:31782734-31782756 TTAATTCAATAACAATTTTCCGG - Intronic
1136727925 16:32376668-32376690 TTATTCCAGTAACAATTTAAAGG - Intergenic
1136966441 16:34916805-34916827 TTAATGCAGTAACCATTGAATGG - Intergenic
1138633495 16:58318247-58318269 TTTATTCAGTAAGTGCTTATTGG - Intronic
1138760616 16:59539469-59539491 TTTATTCAGTTTCTATTTCTAGG - Intergenic
1138883504 16:61046639-61046661 TTAATTCAATACCATTTTATTGG + Intergenic
1138961009 16:62029212-62029234 CTATTGTAGTAACTATTTATTGG + Intronic
1139101495 16:63772603-63772625 TTAATTCAGTTAAAATTTGTGGG + Intergenic
1139585100 16:67897620-67897642 GGAATTCAGTAAATATTTCTGGG + Intronic
1139604950 16:68011540-68011562 TTTATTCAACAAGTATTTATTGG - Intronic
1140140235 16:72249518-72249540 TTCATTCAATAATTATTTACTGG + Intergenic
1140149860 16:72351915-72351937 TTCATTCAGTAAACATCTATTGG - Intergenic
1140301053 16:73757529-73757551 TTAATTCAGTAAATATTTATTGG + Intergenic
1140590027 16:76340622-76340644 TTCATTCAATACATATTTATAGG + Intronic
1141116027 16:81310027-81310049 TTCCTTCAGCAAATATTTATTGG + Intergenic
1141356795 16:83354380-83354402 TTCATTCAACAAGTATTTATCGG + Intronic
1141540267 16:84714748-84714770 TTAATTCATTGATTATTTTTGGG + Intronic
1202994745 16_KI270728v1_random:98297-98319 CTGATTCAGTTACTAGTTATAGG - Intergenic
1202998510 16_KI270728v1_random:141086-141108 TTATTCCAGTAACAATTTAAAGG + Intergenic
1203021432 16_KI270728v1_random:410639-410661 CTGATTCAGTTACTAGTTATAGG - Intergenic
1203130107 16_KI270728v1_random:1677490-1677512 TTATTCCAGTAACAATTTAAAGG + Intergenic
1143706430 17:8700817-8700839 TTCATTCAACAAATATTTATGGG - Intergenic
1144186234 17:12798455-12798477 TTTATTCCGTATATATTTATTGG + Intronic
1144279888 17:13715627-13715649 TCAAGTCAATAACCATTTATCGG + Intergenic
1144587795 17:16498527-16498549 TTCATTCAGCAAGTATTTATGGG - Intergenic
1145096596 17:20034060-20034082 TTACTTTAGAAACTATTTAAAGG - Intronic
1145182543 17:20765935-20765957 TTTATTCCATAAGTATTTATTGG - Intergenic
1145855987 17:28157901-28157923 TTCATTCATCAAATATTTATAGG + Intronic
1145873044 17:28291988-28292010 TTAGGTCAGTAAATATTTGTTGG + Intergenic
1145876946 17:28326194-28326216 TTTGTTCAGTAATTATATATAGG - Intronic
1146196779 17:30819949-30819971 TTCACTCAATAAATATTTATTGG - Intronic
1146476375 17:33165884-33165906 TTCACTCAGTAATTATTTATTGG + Intronic
1147531176 17:41279402-41279424 TTAATTCATTAACAATGCATAGG - Intergenic
1147600069 17:41739918-41739940 TTCATTCAACAAATATTTATTGG - Intergenic
1147798253 17:43061488-43061510 TTTATTCAGTGGCTATTTATTGG - Intronic
1148498438 17:48069880-48069902 TTAATTTAGTAAATACTTACTGG - Intergenic
1148994491 17:51697725-51697747 TTCATTCAGTGAATATTTATGGG - Intronic
1149306713 17:55354872-55354894 TAAATTCAGCAAATATTTATTGG - Intergenic
1149502439 17:57164314-57164336 TTCACTCAATAACTATGTATTGG + Intergenic
1149842060 17:59974112-59974134 TTTATTCCATAAATATTTATTGG - Intergenic
1149956935 17:61061969-61061991 TAGATTCAGTAACTTTTTAAAGG - Intronic
1149986450 17:61351088-61351110 TTCATTCAGTAAACAATTATTGG + Intronic
1150533485 17:66011125-66011147 TTAATTATGTAACTCATTATTGG + Intronic
1150661135 17:67080573-67080595 TCAATCCAATAAATATTTATTGG + Intronic
1150674815 17:67235655-67235677 TCAGTTCAGCAAGTATTTATTGG - Intronic
1150847565 17:68675311-68675333 TTTATTCAATAAATAATTATTGG - Intergenic
1151040215 17:70850684-70850706 TTTATTCAATAAATATTTATTGG - Intergenic
1151069607 17:71193714-71193736 TTCATTCAACAAATATTTATTGG + Intergenic
1151151327 17:72090056-72090078 TTCATTCAACAAATATTTATCGG - Intergenic
1151332350 17:73417895-73417917 ATAATTCAGCATCTAATTATTGG + Intronic
1152495245 17:80666656-80666678 TTCATTCAGCAAATGTTTATTGG + Intronic
1154214216 18:12403678-12403700 TAAATTCAATACATATTTATTGG + Intergenic
1154460303 18:14576963-14576985 TTACTTCAATAATTATTTGTTGG + Intergenic
1155351405 18:24911226-24911248 TTCATTCAGTTGTTATTTATTGG + Intergenic
1155708192 18:28842527-28842549 TTTACTCAGTAGGTATTTATAGG + Intergenic
1156701492 18:39830836-39830858 TTTATTCACCAAATATTTATTGG - Intergenic
1156747185 18:40406674-40406696 TTAATTCATTGAGCATTTATTGG + Intergenic
1156853266 18:41753128-41753150 TTAATTCAGCAAATATCTACTGG - Intergenic
1156992384 18:43425406-43425428 GTAATTAAGTAACTTTTAATGGG + Intergenic
1157095810 18:44684635-44684657 TTAATTAATTAATTATTTAATGG - Intronic
1157211521 18:45746618-45746640 TTAATTTAACAACTATTCATTGG - Intronic
1157760179 18:50257008-50257030 TTCATTCAGTAAGTATTTTTGGG - Intronic
1158142617 18:54270782-54270804 TCAATTTAGTGAATATTTATTGG + Intronic
1158167448 18:54556414-54556436 TTAATTCAAGAAATATTTATTGG - Intergenic
1158183601 18:54745716-54745738 GTCAATCAGTAAATATTTATTGG + Intronic
1158230997 18:55255091-55255113 TTAATTAAGAAACTATAAATAGG - Intronic
1158376705 18:56878490-56878512 TTAATTTAACAAATATTTATTGG - Intronic
1158549224 18:58420688-58420710 TTCATTGAGTAACTATTGATTGG - Intergenic
1159296816 18:66501191-66501213 TTAATTCCAGAAATATTTATTGG + Exonic
1159375937 18:67593162-67593184 TTTATTCAGTCAACATTTATTGG + Intergenic
1159408145 18:68033403-68033425 TTAACTCAGCAAATATTTGTTGG + Intergenic
1159529213 18:69634624-69634646 TTTATTCAATAACTATTTATTGG + Intronic
1159573487 18:70146804-70146826 TTGATTCAGGAAGTATTTATTGG - Intronic
1159834108 18:73315596-73315618 ATAATTCTGTCACTCTTTATTGG + Intergenic
1162848139 19:13409870-13409892 TTTATTCAATAATTATTTGTGGG - Intronic
1164154766 19:22586076-22586098 TTAATTCAATATATATGTATTGG - Intergenic
1164610141 19:29626312-29626334 TTATTTCTGTAACCAGTTATGGG - Intergenic
1165032152 19:33005891-33005913 TTAATTAATTAATTATTTTTTGG + Intronic
1165318624 19:35072932-35072954 TTATTTCTGTAACTGGTTATAGG - Intergenic
1165789842 19:38484669-38484691 TTCATTCAACAAATATTTATGGG + Intronic
1166103712 19:40587161-40587183 TCAATTCAGCAACGATTTACGGG + Intronic
1166674891 19:44734307-44734329 TTCATTCAGTAAATACTTACTGG + Intergenic
1167039647 19:47015480-47015502 TTCATTCAACAAATATTTATCGG - Intergenic
1167393980 19:49215292-49215314 TTTATGCAGTAACTGTGTATTGG + Intergenic
1168141538 19:54391249-54391271 TTCATTCAGTAAGTATTTGTTGG + Intergenic
1202678708 1_KI270711v1_random:31210-31232 ATTATTCAGTAATTATTCATAGG + Intergenic
925156524 2:1652450-1652472 TTATTTCAACAAGTATTTATTGG - Intronic
925497270 2:4466068-4466090 TTTATTTAGTAAGTATGTATTGG + Intergenic
925742037 2:7014269-7014291 TTCATTCAACAACTATTTATGGG - Intronic
926259934 2:11250468-11250490 ATCATTCATTAAATATTTATTGG - Intronic
926566010 2:14474937-14474959 TGAATTAAGTTACTATTTATAGG - Intergenic
926583303 2:14656111-14656133 ATAATTCACTATGTATTTATTGG - Intergenic
926865428 2:17352063-17352085 TTACTTCAATAACTATTGCTTGG - Intergenic
926986249 2:18627429-18627451 TTCATTCAGGCACTATTTATGGG + Intergenic
927346353 2:22047254-22047276 TCAATTAAGTAAATATTTATGGG - Intergenic
927366234 2:22299961-22299983 TTAATTCAATAAAGATTTCTGGG - Intergenic
927372292 2:22370471-22370493 TTCATTCAGTAAATAGTTACTGG + Intergenic
927466855 2:23343366-23343388 TTCATTCAATATGTATTTATAGG + Intergenic
927587817 2:24324534-24324556 TTCATTCAGTAAATGTTTATGGG + Intronic
927734625 2:25508244-25508266 GTCATTCAGCAAATATTTATTGG - Intronic
928065048 2:28155620-28155642 TCAGTTCTATAACTATTTATTGG + Intronic
928068624 2:28192465-28192487 CTAATGCAGTCACAATTTATGGG + Intronic
928117332 2:28555682-28555704 TTAGTTCAGCAAATATTTATTGG - Intronic
928188615 2:29139648-29139670 TCAATTTTGTAACTAATTATTGG + Intronic
928276600 2:29906390-29906412 TTAATTCAACAAATAATTATTGG - Intronic
928322994 2:30298025-30298047 TTAATTTAAGAGCTATTTATGGG - Intronic
929140289 2:38660997-38661019 TTAATTAATTAATTATTTTTTGG - Intergenic
929253288 2:39781935-39781957 TTCATTTAGTTACTTTTTATTGG - Intergenic
929326436 2:40617136-40617158 TAATTTCAGTAACTGTTTTTGGG + Intergenic
929368509 2:41192161-41192183 TTCATTCAACAACTATTTATTGG - Intergenic
929479042 2:42285072-42285094 TTAATTAATTAATTAATTATAGG + Intronic
929918126 2:46153322-46153344 TTTATTCTATAAATATTTATTGG + Intronic
930249881 2:49023335-49023357 TTCATCCAGTAATCATTTATTGG - Intronic
930269434 2:49239174-49239196 TTAATTCATTTAATATTCATAGG - Intergenic
930449539 2:51517763-51517785 TTAATTCAGAAAGAAATTATTGG - Intergenic
930464205 2:51724663-51724685 TTATTTCATTAAATATTTATTGG + Intergenic
930509941 2:52331901-52331923 TCAATTCAATTAATATTTATTGG - Intergenic
930589205 2:53307292-53307314 TTCCTTCAATAAATATTTATTGG + Intergenic
930704444 2:54490401-54490423 TAAATTCAGAAAGTATTTAAGGG + Intronic
930885142 2:56316748-56316770 TTTATTCAGCAAACATTTATGGG - Intronic
931004545 2:57833059-57833081 TTTATTCAATACATATTTATAGG + Intergenic
931009733 2:57896429-57896451 TTCATCCATTAAATATTTATTGG + Intergenic
931009964 2:57899456-57899478 TAAATTCAGCAGGTATTTATTGG + Intergenic
931306379 2:61033438-61033460 TTAACTCAATAAATATTTGTTGG + Intronic
931327803 2:61245070-61245092 TTTATTCAGTTTATATTTATTGG - Intronic
931435186 2:62239805-62239827 TTCATTCAACAACTATCTATTGG - Intergenic
931680477 2:64743361-64743383 TTAATTCAACAGATATTTATTGG - Intronic
931915514 2:66950859-66950881 GAAATTCAGCAAATATTTATTGG - Intergenic
932030449 2:68178263-68178285 TTAATTTATTAATTATTTATTGG + Intronic
932911349 2:75809437-75809459 TTCTTTCAGTAAGTTTTTATAGG - Intergenic
933063836 2:77770129-77770151 TTAACTCAGTTAGCATTTATAGG - Intergenic
933092930 2:78144739-78144761 TTAATAAACTAAATATTTATCGG - Intergenic
933184422 2:79262864-79262886 TTTACTCAGAAAATATTTATGGG + Intronic
933435739 2:82247413-82247435 TTGATTCAGCAAATATTTAAGGG + Intergenic
933938274 2:87224754-87224776 TTTATTCACAAACTATTTATTGG - Intergenic
934314076 2:91900302-91900324 CTGATTCAGTTACTAGTTATAGG - Intergenic
934579357 2:95426288-95426310 TTCATTCATTCACTATGTATTGG + Intergenic
934600086 2:95650436-95650458 TTCATTCATTCACTATGTATTGG - Intergenic
935119564 2:100171910-100171932 TTGATTCAGTAAGTTTATATGGG + Intergenic
935487679 2:103677984-103678006 TTAATTCAGTCTCCATTTCTTGG + Intergenic
936043774 2:109170705-109170727 TTAATTAAATAAATATTTGTTGG + Intronic
936142371 2:109951352-109951374 TTATTTCTGTAAATTTTTATTGG - Intergenic
936179061 2:110249311-110249333 TTATTTCTGTAAATTTTTATTGG - Intergenic
936202317 2:110420121-110420143 TTATTTCTGTAAATTTTTATTGG + Intronic
936354861 2:111741021-111741043 TTTATTCACAAACGATTTATTGG + Intergenic
936533427 2:113292436-113292458 TTCATTCATTCACTATATATTGG - Intergenic
936669876 2:114644722-114644744 GTTATTCAGTCAATATTTATTGG + Intronic
936763521 2:115816068-115816090 TTAATTCAGTAACTATTTATTGG + Intronic
936842056 2:116781971-116781993 TTAATTCAGCAATTAGTTTTAGG - Intergenic
938915680 2:135936842-135936864 TTAAATCAGTAAGTACATATAGG + Intronic
939208937 2:139146052-139146074 TAAATTTAATAAGTATTTATTGG + Intergenic
939255109 2:139733391-139733413 TAAATTCAATAAATGTTTATGGG + Intergenic
939469414 2:142600633-142600655 TTTATTGAATAAATATTTATTGG + Intergenic
939571606 2:143846649-143846671 TTCATTCAATAGCTATTAATGGG - Intergenic
939708165 2:145480855-145480877 TTACTTAATTAATTATTTATTGG - Intergenic
939764682 2:146232032-146232054 TTCATTCAATAAACATTTATTGG + Intergenic
939819825 2:146944176-146944198 TTTATTCAACAAGTATTTATTGG + Intergenic
940748333 2:157596078-157596100 GTAATTCAGTACATCTTTATTGG - Intronic
940795213 2:158070583-158070605 TTAATTAAGCCACTGTTTATGGG + Intronic
940845127 2:158632098-158632120 TTCATTTAGTACCTATTTATAGG + Intronic
941213120 2:162667921-162667943 TATATTCAATAAATATTTATTGG + Intronic
941262527 2:163315657-163315679 TTAATCTAGTAGCTATTTAAAGG + Intergenic
941464384 2:165808592-165808614 TTCATTCAAAAACTATTTGTGGG + Intergenic
941591075 2:167421471-167421493 TTAATGTAGTTACTCTTTATAGG + Intergenic
941620542 2:167773104-167773126 TTAATTCAATAAGTGTTTTTAGG + Intergenic
941907868 2:170734544-170734566 ATAATTCTGTCACAATTTATTGG + Intergenic
942129510 2:172864601-172864623 TTCATTCAGTAAGGAGTTATTGG + Intronic
942351062 2:175053369-175053391 TTAATTCAACATCTATTTTTTGG - Intergenic
942516497 2:176759038-176759060 TTTATGCAGTACATATTTATTGG + Intergenic
942538807 2:176994207-176994229 TTGATTCAACAAATATTTATTGG + Intergenic
942553078 2:177141113-177141135 TTGATTCATTAACTATAGATTGG + Intergenic
942760738 2:179394557-179394579 TTAATTTGGTAATTATTTGTAGG - Intergenic
943086390 2:183317121-183317143 TTAAGTCCATAAATATTTATTGG + Intergenic
943181710 2:184552276-184552298 TTACTTGAAAAACTATTTATAGG + Intergenic
943221331 2:185110442-185110464 TTTATTCAGTCACCATTGATGGG - Intergenic
943453885 2:188078829-188078851 TTCTTTCAGTTACTATTTTTGGG + Intergenic
943567129 2:189529329-189529351 TTCATTCAACAAATATTTATTGG + Intergenic
943888956 2:193260653-193260675 TTAAATAACAAACTATTTATTGG + Intergenic
944245462 2:197525740-197525762 TTCAATCAGCAAATATTTATTGG + Intronic
944626771 2:201577971-201577993 TAAATACAGTATATATTTATGGG - Intronic
944698112 2:202221265-202221287 TCATTTCAGTATCTCTTTATTGG - Intronic
944933440 2:204544337-204544359 TACATTCAGTAAGTATATATTGG - Intergenic
944946087 2:204687523-204687545 TTAATTCAGTAAGTATTTTTGGG - Intronic
945038772 2:205727150-205727172 TCAATTCAGTAAGCACTTATTGG - Intronic
945177786 2:207060978-207061000 TTCATTAGGTAAATATTTATTGG - Intergenic
945466225 2:210172674-210172696 TTAAATCAGTAAGTATTTATTGG + Intergenic
945504688 2:210625203-210625225 TCTATTCAGTCATTATTTATTGG + Intronic
945698634 2:213141840-213141862 TCAATTCAATAAATATTTGTGGG - Intronic
945714716 2:213344168-213344190 TTAATTGAGTGACTATGTACTGG - Intronic
946547760 2:220764028-220764050 TTTATTCAAGAACTATATATTGG - Intergenic
946881162 2:224178549-224178571 TTCTTTCAGCAAATATTTATTGG + Intergenic
946906895 2:224426302-224426324 TTCATTCAGTGACTAGTTATTGG + Intergenic
946993073 2:225358100-225358122 TTAATGCAGAAAATTTTTATAGG + Intergenic
947196389 2:227572277-227572299 TAATTTCAGTGACTATTTTTTGG - Intergenic
947269335 2:228316687-228316709 TTAATTCAGTAAATGCTTATTGG - Intergenic
947328731 2:229005566-229005588 TTATTTTATTTACTATTTATAGG - Intronic
947823648 2:233089719-233089741 TTTATTCAGTGAATATTAATTGG + Intronic
948021300 2:234735891-234735913 TTCATTCTGTTAGTATTTATTGG - Intergenic
948255190 2:236563271-236563293 TTCATTTAGTCAATATTTATGGG + Intergenic
1169650066 20:7857176-7857198 TTAACTCAACAAATATTTATTGG - Intergenic
1170131983 20:13030594-13030616 TTCATTCATTAAATATTTACTGG + Intronic
1170187584 20:13608401-13608423 TTAATTCAACAAATATTTATTGG + Intronic
1170254144 20:14320723-14320745 TTAATTTAGTAAGTCTTTACTGG + Intronic
1170272486 20:14543410-14543432 TTAATTCATAAACTACATATAGG - Intronic
1170356342 20:15496248-15496270 TTAAATCAGTAACTTTGAATCGG + Intronic
1171166634 20:22977652-22977674 TTATTTCAGGAACAATTTAATGG - Intergenic
1171510721 20:25682214-25682236 ATAATACAGTAACTATTATTAGG + Intronic
1172064358 20:32208391-32208413 TTGATTCAGCAAATATTTATGGG + Intronic
1173059730 20:39650166-39650188 TTAAATCAACAAATATTTATTGG + Intergenic
1173078653 20:39845125-39845147 TATATTCAGCAAATATTTATTGG + Intergenic
1173137272 20:40449662-40449684 TTCATTCAATAACCATTTGTTGG - Intergenic
1173147420 20:40536803-40536825 TTTATTCATCAAATATTTATTGG + Intergenic
1173678219 20:44856725-44856747 TTAATTCAGTCACTGTTCCTTGG - Intergenic
1173896874 20:46557831-46557853 TTCATTCAATAAACATTTATTGG - Exonic
1174438427 20:50528771-50528793 TTCATTCAGGAACTACTTATTGG - Intronic
1174795266 20:53517056-53517078 TTTATTCAGTAAACATATATAGG + Intergenic
1174952547 20:55058617-55058639 TTCATTCAGTACATATTTATTGG + Intergenic
1175268616 20:57717982-57718004 TTCATTCAGCAAATATTTATTGG - Intergenic
1176813806 21:13575857-13575879 TTACTTCAATAATTATTTGTTGG - Intergenic
1177198449 21:17927822-17927844 TTCATTTAACAACTATTTATTGG - Intronic
1177465904 21:21479923-21479945 TTAATTTAAGAATTATTTATTGG + Intronic
1177490215 21:21814201-21814223 TTAATAAAGTAACCATTTACAGG - Intergenic
1177715172 21:24831187-24831209 CTAATTCAGTAACCTTTTTTGGG + Intergenic
1178017312 21:28364298-28364320 TAAATTAATTAATTATTTATAGG + Intergenic
1178132937 21:29593648-29593670 TTAATTAAGTAAGTATTGAAGGG + Intronic
1178512898 21:33221295-33221317 TTAAAACACTAACTATTTCTAGG + Intergenic
1179142584 21:38739640-38739662 TTCATTCAGCAAATATTTACTGG + Intergenic
1179373186 21:40825971-40825993 TTCAATCAGTAACTACTTACTGG + Intronic
1180540832 22:16446167-16446189 CTGATTCAGTTACTAGTTATAGG - Intergenic
1181378171 22:22477172-22477194 TTCATTCTGTAAATTTTTATTGG + Intergenic
1181446873 22:22983733-22983755 TTCATTCAGTAAGTATTTGAGGG - Intergenic
1181657466 22:24315413-24315435 TTTGCTCAGTAAATATTTATTGG + Intronic
1181839445 22:25643808-25643830 TTCATTCAGTGAACATTTATTGG + Intronic
1182404645 22:30115560-30115582 TTCATTCAGCAAATATTAATTGG + Intronic
1182587591 22:31353949-31353971 TTCATTCAAGAAGTATTTATGGG + Intergenic
1182972724 22:34592994-34593016 CTAATTCAATAGATATTTATTGG + Intergenic
1183244233 22:36681479-36681501 TTAATTCAGTAAGCATTTACAGG - Intronic
1183580727 22:38724890-38724912 TTCATTCCATAAATATTTATTGG + Intronic
1183931695 22:41239188-41239210 TGAATTCAGTATCGATCTATGGG + Intronic
949199336 3:1354667-1354689 TTAAATCAATAAATATTTACTGG - Intronic
949216062 3:1568499-1568521 TTTATTCAACAAATATTTATTGG - Intergenic
949341344 3:3034292-3034314 TTAATTCATTATTTATTTATAGG - Intronic
949408890 3:3742534-3742556 TTCATTCATTCAATATTTATTGG - Intronic
949446965 3:4145316-4145338 TTCATTCAGCAAATATTTACTGG - Intronic
949560273 3:5195086-5195108 TTTATTCAGGAACTAATTATGGG - Intronic
949823215 3:8137756-8137778 CTCATTCAGTAGATATTTATGGG - Intergenic
949868113 3:8563414-8563436 TTCATTCAGCAACTATTGATGGG + Intronic
949978034 3:9478393-9478415 TTCATTCAGCAACTATTTATTGG + Intronic
950021483 3:9791045-9791067 CTAATTCAGTAAGCTTTTATTGG - Intronic
950571384 3:13802280-13802302 CTCATTCAATAAGTATTTATTGG + Intergenic
950866314 3:16192071-16192093 GTAATTCACTCAATATTTATAGG - Intronic
951218169 3:20043229-20043251 TTCATTCAGTAAATATTTAGAGG + Intronic
951431835 3:22616982-22617004 ATCACTCAGTAACTATTTACGGG + Intergenic
951444285 3:22759676-22759698 TTAATTCAGTTATGATATATGGG - Intergenic
951731092 3:25810907-25810929 TTAATTCATTAAGCATTTATTGG + Intergenic
951772429 3:26273451-26273473 TTCATTCATCAAGTATTTATTGG + Intergenic
951779917 3:26350845-26350867 ATAATTCAGTAAATGTTTTTGGG + Intergenic
951987437 3:28636282-28636304 TTTATTTAGCAAATATTTATTGG + Intergenic
952094244 3:29929606-29929628 TTGATTCAGTAACTAGTAACTGG - Intronic
952685031 3:36137337-36137359 AATATTCAGTAACTCTTTATTGG + Intergenic
952961837 3:38597124-38597146 TGAATTCAACAAATATTTATTGG + Intronic
953093009 3:39748260-39748282 TTTATTGAGTGACTAATTATTGG - Intergenic
953097874 3:39796528-39796550 TTTCTTCAGTAAGTATTTATTGG + Intergenic
953553000 3:43918849-43918871 TTGATTCAATAAACATTTATTGG - Intergenic
953613779 3:44471329-44471351 TCAGTTCAGTGGCTATTTATGGG - Intronic
954243075 3:49309390-49309412 TTAATTCATCAAATATTTATTGG - Intronic
954477691 3:50763997-50764019 TTAATTAATTCACTATTTGTAGG + Intronic
955607393 3:60720362-60720384 TTTATTCAACAAATATTTATGGG - Intronic
955610061 3:60747470-60747492 TTTATTCAGCAAAAATTTATTGG - Intronic
955669319 3:61385962-61385984 ATAATACAGTAGCTATTCATAGG + Intergenic
955732564 3:62002403-62002425 TTCATTCAATAAATACTTATTGG - Intronic
955893413 3:63674321-63674343 TTAATTCAATAAAAATATATTGG + Intronic
955976635 3:64486338-64486360 TTCATTCAGTAACCATTTATTGG - Intergenic
956009134 3:64812092-64812114 TGAATACAGTAAATATTGATAGG + Intergenic
956079301 3:65540622-65540644 TTTATTCAAAAACTATCTATTGG + Intronic
956410636 3:68974715-68974737 TTCATTTAGTAAATATTGATTGG - Intergenic
957348326 3:78990794-78990816 CTCATTCAGCAACTATTGATGGG - Intronic
957352540 3:79044620-79044642 TTTGTTCAGTATCTATCTATGGG + Intronic
957602526 3:82356470-82356492 TTAGTTTAGCAAATATTTATTGG + Intergenic
958087044 3:88823567-88823589 TGTATTGAGTAACTATTTATTGG + Intergenic
958776515 3:98489440-98489462 ATAATTAAGTAATTATTGATAGG - Intergenic
958780424 3:98534265-98534287 TTGACTCAATAAATATTTATTGG - Intronic
958791570 3:98657288-98657310 TTGTTTCTGTAACAATTTATAGG + Intergenic
959021149 3:101188506-101188528 TTAATTTTGTAACTTGTTATTGG - Intergenic
959431856 3:106263989-106264011 TTCATTCAGCAACTATATATTGG - Intergenic
959678996 3:109071398-109071420 CTCATTCAGTAACTAGTTATAGG + Intronic
959716201 3:109435704-109435726 TTCCTCCAGTAACTATATATTGG + Intergenic
960061638 3:113328996-113329018 TTAATTTAGCAAATATTTATTGG - Intronic
960215088 3:115024230-115024252 AGGATTCAGTAAATATTTATTGG - Intronic
960334733 3:116402567-116402589 ATAATTAATTCACTATTTATTGG + Intronic
960403081 3:117227695-117227717 TTCCTTCAATAAATATTTATTGG + Intergenic
960458507 3:117903274-117903296 TTCATTCAACAAATATTTATAGG - Intergenic
960688676 3:120320675-120320697 TAAACTCAGTCATTATTTATAGG + Intergenic
960692208 3:120358563-120358585 TTAATTCAACAAATACTTATTGG + Intergenic
960758461 3:121046526-121046548 TTAATTTTGGAACTCTTTATTGG + Intronic
961099256 3:124184800-124184822 TTAATTCAACAATCATTTATTGG - Intronic
961228525 3:125277828-125277850 TTTATTCAGTAACTAATTTGTGG - Intronic
961852863 3:129839194-129839216 TTAAAGCAGTAACAATGTATTGG + Intronic
961991393 3:131195941-131195963 TTCATTAAGCAAGTATTTATCGG - Intronic
963016621 3:140829947-140829969 TTCAATCAGTAAATATTTCTTGG - Intergenic
963093538 3:141510505-141510527 TTAATTCAGTGTTTATTTTTTGG - Intronic
963785973 3:149534794-149534816 TGAAGTGAGTAATTATTTATGGG + Intronic
964200887 3:154117988-154118010 TACATTCAACAACTATTTATTGG - Intergenic
964284558 3:155103231-155103253 TTTATTCAATCAATATTTATTGG - Intronic
964424982 3:156543049-156543071 GTAATTCAGTATTTGTTTATTGG - Exonic
964449081 3:156792777-156792799 TTCATTCAACAAATATTTATTGG + Intergenic
964463103 3:156958662-156958684 TTTTTTCAGCAAGTATTTATTGG + Intronic
964930220 3:162010856-162010878 TTCATTCAATAAATATTTAGAGG + Intergenic
965290164 3:166868358-166868380 TTAATTCAATAAATATGAATTGG + Intergenic
965430460 3:168581186-168581208 TTTTTTCACTAACTAGTTATAGG - Intergenic
965448423 3:168805568-168805590 CTTATTCAGTGACTATGTATGGG - Intergenic
965700096 3:171451791-171451813 TTCATTCAGTACCTGATTATTGG - Intronic
966271078 3:178106524-178106546 ATTATTTTGTAACTATTTATTGG + Intergenic
966999754 3:185322726-185322748 TTCATTCAATAAATATTTGTTGG - Intronic
967222909 3:187263622-187263644 TTAATACAGAAACTATTTATTGG + Intronic
967289237 3:187902965-187902987 TTAATCCAGTAACTGTTGAGAGG - Intergenic
967492142 3:190104922-190104944 TGCATTATGTAACTATTTATAGG + Intronic
967761829 3:193234534-193234556 TTCATTCAACAACTAGTTATTGG + Intergenic
968637817 4:1691146-1691168 TTAATTCTGTGACTCTTAATAGG + Intergenic
969629112 4:8325174-8325196 TTCATTCAACAAATATTTATTGG - Intergenic
969919524 4:10524517-10524539 TTGATTCAATAATTATTTACTGG - Intronic
969987237 4:11225050-11225072 TTCATTCAGCAAATATTTAACGG - Intergenic
969997267 4:11325749-11325771 TTTATTCAACAAATATTTATTGG + Intergenic
970226192 4:13859629-13859651 TTCATTCAAAAAATATTTATTGG - Intergenic
970308115 4:14753842-14753864 TCAATTTAATAAATATTTATTGG - Intergenic
970699322 4:18715934-18715956 TTTATTCAATAAATATTTACTGG - Intergenic
971221134 4:24706921-24706943 TTAATTCTGTATACATTTATAGG + Intergenic
971348816 4:25838059-25838081 TTCATTCATCAAATATTTATGGG - Intronic
971832050 4:31707106-31707128 TTAATTCAACAAATATGTATTGG - Intergenic
972207006 4:36785848-36785870 TTCATTCAGAAAATATTTAATGG + Intergenic
972209010 4:36814436-36814458 TTCATTCAGCAAATATTTATGGG - Intergenic
972408662 4:38769828-38769850 TGAATTCATTAACTAATTAAAGG + Intergenic
972632607 4:40855336-40855358 TTTATTTAATAAGTATTTATTGG - Intronic
973015946 4:45137173-45137195 TTAATTAAGTCACTATGTATAGG + Intergenic
973038252 4:45436371-45436393 TTAATTTAAAAAGTATTTATTGG - Intergenic
973181677 4:47276468-47276490 TCATTTCAGGAACTATTTCTCGG - Intronic
973225316 4:47777176-47777198 GTTAATCAGTAGCTATTTATTGG - Intronic
973257182 4:48125334-48125356 CTCATTCAGCAACTATTTATTGG + Intronic
973304357 4:48628262-48628284 TTAAATCAGTCTCTATTGATAGG - Intronic
973635588 4:52859384-52859406 TGAATTCAATAAATATTTATTGG - Intergenic
973679855 4:53305959-53305981 TTAATTCCGTAAACATTTCTTGG + Intronic
973729550 4:53810515-53810537 TTGATTCAGTCACCATTTCTTGG - Intronic
974058440 4:57008010-57008032 GTAATTCAGTAAGGATTTATTGG + Intronic
974118500 4:57609865-57609887 TTAATTAAATAAACATTTATTGG + Intergenic
974306387 4:60147041-60147063 TTAATTCAGTAATAATTTTCAGG + Intergenic
974335243 4:60535425-60535447 TTCATTCAGTAACTATTCACTGG + Intergenic
974486427 4:62511663-62511685 TGTATTCAATAAATATTTATTGG + Intergenic
974616938 4:64300082-64300104 ATAATTCAGGCAGTATTTATTGG + Intronic
974647080 4:64708875-64708897 TTTATTCAGTAAACATTTATTGG + Intergenic
974708569 4:65557444-65557466 TTGATTCAGCAAATATTTATAGG + Intronic
974805616 4:66876549-66876571 TTCATTCAGTAAATTTTTATGGG + Intergenic
975101164 4:70514520-70514542 TTAATTCAGTGGCTGTTTTTCGG + Intergenic
975171162 4:71233227-71233249 TTCATTCAGTAAATATTTACTGG - Intronic
975425490 4:74221887-74221909 TTAATTCTCTATTTATTTATAGG + Intronic
975482424 4:74895871-74895893 AAAATTCAGCAACTATTTATTGG + Intergenic
975544869 4:75550118-75550140 TTCATTCAACAACTATTTATTGG - Intronic
975611101 4:76204298-76204320 TTAACTCAGTAAAAATGTATTGG + Intronic
976017470 4:80575128-80575150 TTAATTTTGTTACTTTTTATTGG + Intronic
976034948 4:80806471-80806493 TTCATTCAGCAAATATTTATTGG + Intronic
976075579 4:81295850-81295872 TTAATTCCATAAATATGTATTGG - Intergenic
976133765 4:81912727-81912749 TTAATGCAACAATTATTTATTGG - Intronic
976357640 4:84137757-84137779 TTAATGCTGTAACTATTTGGGGG + Intergenic
976815462 4:89143027-89143049 TTAATTCAGAAAGCATTTGTAGG + Intergenic
977078545 4:92491139-92491161 GTGATTCAGCAAATATTTATCGG - Intronic
977345975 4:95816531-95816553 TTAAATCTGTAAATATATATGGG - Intergenic
977828542 4:101562566-101562588 TTCATTCAGCAAACATTTATTGG - Intronic
977839570 4:101686162-101686184 TTAATTCAACAAATATGTATTGG + Intronic
977946289 4:102918375-102918397 CTGATTCAGTTACTAGTTATAGG - Intronic
977998380 4:103524469-103524491 TTAAGTCAGAATTTATTTATGGG + Intergenic
978057759 4:104293623-104293645 TCATTTCAGCTACTATTTATTGG + Intergenic
978146981 4:105386745-105386767 TTCATTCAGTTTCTATTCATTGG - Intronic
978245470 4:106567048-106567070 TTCATTCAACAAGTATTTATTGG + Intergenic
978261477 4:106765827-106765849 TTTATTCAATAAATATTAATGGG - Intergenic
978315437 4:107430666-107430688 TTCATTCAACAAATATTTATTGG - Intergenic
978391928 4:108236126-108236148 ATGATTCAGGAAGTATTTATTGG - Intergenic
978550818 4:109924473-109924495 TCAAGTCAGCAAGTATTTATTGG + Intronic
978902387 4:113968006-113968028 AACATTCATTAACTATTTATGGG + Intronic
978985312 4:115005059-115005081 TTAATTCTATAAATATTTATGGG + Intronic
979428421 4:120596700-120596722 TCAATTTTGTAACTAATTATGGG - Intergenic
979496971 4:121394537-121394559 TCTATTCAGCAATTATTTATTGG - Intergenic
979566692 4:122162157-122162179 TCCATTCAATAAATATTTATTGG - Intronic
979627534 4:122862160-122862182 TTAATTCAATTAACATTTATGGG - Intronic
980106276 4:128591551-128591573 CAAATTCAGTAACTAATCATTGG + Intergenic
980518028 4:133890037-133890059 TTAATTTAGGAACTATTTTATGG - Intergenic
980544840 4:134245424-134245446 TTTATTCAACAAATATTTATTGG - Intergenic
980576730 4:134692511-134692533 TTAATATAGTGATTATTTATTGG + Intergenic
981166861 4:141569906-141569928 TTAATTCTGTAACTATAAATTGG + Intergenic
981761227 4:148197390-148197412 TTAATTCAATAAGTATTTATGGG + Intronic
981762065 4:148205566-148205588 TTAATTCAACAAATAATTATCGG + Intronic
981773884 4:148342362-148342384 TTAATTCAACAAACATTTATAGG + Intronic
981887799 4:149698392-149698414 TTTATTCAGCAAACATTTATTGG - Intergenic
981949884 4:150393269-150393291 TTCATTCAGCAAATATGTATTGG - Intronic
982063562 4:151629291-151629313 GTCATTCAGTAAACATTTATTGG - Intronic
982472253 4:155806716-155806738 TAAATTCAACAAATATTTATTGG - Exonic
982687743 4:158511882-158511904 TTAATTCAGTTGCTTTTTAAAGG - Intronic
983056695 4:163105399-163105421 TTACTTTAGGAACTATTTACAGG - Intergenic
983526353 4:168764002-168764024 TTACTGCAGTAAATATTTATAGG - Intronic
983548623 4:168991124-168991146 TTAACTCAATGAATATTTATTGG + Intronic
983706440 4:170665923-170665945 TTAATTCAATACATATTTATTGG + Intergenic
983803506 4:171965173-171965195 TTGATTCAACAAATATTTATGGG - Intronic
984106236 4:175550248-175550270 TTATTTTAGTGACTAGTTATTGG + Intergenic
984549589 4:181144738-181144760 TTATTTCAGAAAAGATTTATTGG + Intergenic
984569791 4:181378105-181378127 TTAATTTAGGTGCTATTTATGGG - Intergenic
984570601 4:181388188-181388210 TTCATTCAACAAATATTTATTGG + Intergenic
984848085 4:184124995-184125017 CTAGTTGAGTAAATATTTATTGG + Intronic
985019761 4:185675046-185675068 TTTATTCAAGAAATATTTATTGG - Intronic
985372427 4:189300217-189300239 TTAATTCAATATATATTTATTGG - Intergenic
985898127 5:2762782-2762804 TTAATTAATTAATTAATTATTGG + Intergenic
986223635 5:5792990-5793012 TTAATTCAACAAATATTTATTGG - Intergenic
986278342 5:6301696-6301718 TTCATTCAGCAAATATTTATTGG + Intergenic
986683556 5:10255454-10255476 TTCATTCAACAAATATTTATTGG + Intronic
986724561 5:10584646-10584668 TTTATTTAGCAAATATTTATTGG + Intronic
986800633 5:11256690-11256712 TTAATTCAGCAAACATTTACGGG + Intronic
986970232 5:13326135-13326157 TTAATTAATTTGCTATTTATAGG + Intergenic
987067111 5:14300846-14300868 TTAATTCTAAAAATATTTATGGG - Intronic
987191531 5:15483763-15483785 TTGATTGAGTAACTCTTAATAGG - Intergenic
987491668 5:18588263-18588285 TTAATTCACTAAATAATTACAGG - Intergenic
987507091 5:18786469-18786491 TTATTTAATTAATTATTTATTGG + Intergenic
987549148 5:19355950-19355972 GTAAATCAGTCACTATTTATAGG - Intergenic
987911074 5:24146454-24146476 TTAATTCAAGAACTGTTTCTGGG + Intronic
987965818 5:24871114-24871136 TTAATTCAATAATTAATTTTGGG + Intergenic
988071359 5:26292433-26292455 TTAATATTGTAATTATTTATTGG - Intergenic
988206306 5:28140286-28140308 ATATTTCAATAAATATTTATAGG + Intergenic
988224655 5:28397806-28397828 TTTATTCAGTAACTACTGACAGG + Intergenic
988335786 5:29907455-29907477 ATCATTCAGTAAATATTTATTGG - Intergenic
988351861 5:30118797-30118819 TTACTTCAATCACTATTTGTAGG + Intergenic
988373951 5:30408829-30408851 TTCAATGAGTAAATATTTATTGG - Intergenic
988660311 5:33259325-33259347 TTCATTCAGCAAATATTTATTGG + Intergenic
988687260 5:33537148-33537170 TTAGTTTGGTAACTATTTATTGG + Intronic
988773360 5:34453286-34453308 TTATTTCTGCAACTAGTTATAGG - Intergenic
989011102 5:36874711-36874733 TTCATTCAGCAAGTATTTATTGG - Intergenic
989109613 5:37894734-37894756 TTCATTCAAGAAGTATTTATTGG - Intergenic
989203520 5:38788915-38788937 TTAAGTCAGTATGAATTTATGGG - Intergenic
989477108 5:41886819-41886841 CTAATTCAAAAACTATTTAAAGG - Intergenic
990025606 5:51183803-51183825 TTTATTCAGAAAATATTTATTGG + Intergenic
990067311 5:51734349-51734371 TTTATTGACTAATTATTTATGGG + Intergenic
990100959 5:52186337-52186359 TTGATTTAGTAGCTAATTATTGG - Intergenic
990702807 5:58493578-58493600 TTCATTCAATAAATATTGATTGG + Intronic
990758673 5:59104265-59104287 CTAACTCAGTAATTCTTTATGGG - Intronic
990894875 5:60688055-60688077 TTCATTCAGCAAATATTTCTAGG + Intronic
991205775 5:64048858-64048880 TTATTTCTGCAACTAGTTATAGG - Intergenic
991337618 5:65566619-65566641 TTAATTTAGCAACTTTTTTTAGG + Intronic
991470954 5:66968587-66968609 TTAAATCAATATATATTTATGGG - Intronic
991586394 5:68206453-68206475 TTAATTCAGAAAGTATTTATTGG + Intergenic
991603831 5:68380387-68380409 TTCTTTCAATAGCTATTTATGGG + Intergenic
991614637 5:68483238-68483260 TTAAATCACTAACTATCAATGGG + Intergenic
991627812 5:68622471-68622493 TTCATTCAACAAATATTTATTGG - Intergenic
992265131 5:75011062-75011084 TTCATTCAGCAAATATTTACTGG + Intergenic
992326113 5:75661846-75661868 TTCATTTATTAACTATGTATTGG - Intronic
992516083 5:77493354-77493376 TTAATTCAGCAAACATGTATTGG + Intronic
992535438 5:77697332-77697354 TTACTTCAGTAAATATTTCATGG - Intronic
992712798 5:79477259-79477281 ATAATCCGGAAACTATTTATTGG + Intronic
992775318 5:80083790-80083812 TTAATTCAGTAAACATTTACTGG - Intergenic
993468228 5:88273562-88273584 TATATTCAATAACTATTTAATGG - Intergenic
993518938 5:88874601-88874623 TTAATTTCTTAACAATTTATCGG + Intronic
993639695 5:90387416-90387438 TTAATTCACATACTCTTTATTGG - Intergenic
993773324 5:91959751-91959773 TTAATTAGGTTACTATTTGTAGG - Intergenic
993912327 5:93698741-93698763 TGTACTCAGTAAATATTTATTGG - Intronic
994426967 5:99602351-99602373 TTAATTAATTAATTATTTTTGGG + Intergenic
994668747 5:102740607-102740629 TTTATTCAACAAATATTTATTGG - Intergenic
994726901 5:103446763-103446785 TTAATGCACAAAATATTTATTGG - Intergenic
994798515 5:104338730-104338752 TTAATATAGCAATTATTTATTGG + Intergenic
994840520 5:104919467-104919489 TTAATTCAGTAAATACATATTGG - Intergenic
995031586 5:107487842-107487864 TAAATTCAGCAAATATTTGTTGG - Intronic
995540566 5:113182237-113182259 TTCATTCAGTTAGTATTTACCGG + Intronic
995608671 5:113886517-113886539 TTAATTCAGTAGACATTTATTGG + Intergenic
995849056 5:116525375-116525397 TTAATTAAATAACTCTTCATGGG - Intronic
997044446 5:130297233-130297255 TTTATTGAGTAAATATATATGGG - Intergenic
997307880 5:132852876-132852898 TTAATTTATTCAATATTTATTGG - Intergenic
997815522 5:137013679-137013701 TAAATTCTGAAAGTATTTATGGG - Intronic
998124383 5:139606751-139606773 TTCATTCAGTAACTATTTTGGGG + Intronic
998268465 5:140684730-140684752 CTAATACAGTAAATATTGATAGG - Intronic
998366290 5:141634660-141634682 TTTATTCAATAAATATTTATTGG - Intronic
998408249 5:141886991-141887013 TTAAGTCATAAAATATTTATTGG + Intergenic
998538136 5:142953237-142953259 TTAATTCAGTGAATATTTATTGG + Intronic
998734314 5:145118052-145118074 TTAATTCATCAAATATTTAGTGG - Intergenic
998876460 5:146605105-146605127 TTAACTCACTCACTATTCATAGG + Intronic
998921204 5:147070247-147070269 TTTATTCAGTAAATATATATGGG - Intronic
999372705 5:151065548-151065570 TTAATTGAGTAAGTGTTTATTGG - Intronic
999519021 5:152331223-152331245 TTATTTCATTAAATATTTACTGG - Intergenic
999687484 5:154115990-154116012 CTCATTCAGTAAATATTTATGGG - Intronic
999690237 5:154140121-154140143 TTCATTCAACAAATATTTATTGG - Intronic
999962775 5:156775132-156775154 TTATTACAGTCACAATTTATAGG - Intergenic
1000396106 5:160776235-160776257 TTAATTCTTCAAATATTTATGGG - Intronic
1000666645 5:164006033-164006055 TTAATTTACTAAATATTTATTGG + Intergenic
1001862399 5:175068811-175068833 TTCACTCAGTAACTCTTTATTGG - Intergenic
1002120814 5:177003015-177003037 TTCACTCAGCAAATATTTATAGG - Intronic
1003103707 6:3197278-3197300 TTTATTCAACAAATATTTATGGG - Intergenic
1003344052 6:5248899-5248921 TTCATTCAGCAAACATTTATTGG - Intronic
1003366109 6:5476516-5476538 TTCATCCAATAACTATTTATTGG - Intronic
1003442163 6:6153111-6153133 TTAATTTAATAAATATTTACTGG - Intronic
1003707478 6:8550004-8550026 TTCATTCAGCAACAATTTATTGG + Intergenic
1004275479 6:14231945-14231967 TTGATTCAGCAAATATCTATTGG + Intergenic
1005123763 6:22421424-22421446 ATCATTCAGGAAATATTTATTGG + Intergenic
1005322080 6:24665574-24665596 TACATTCAGTAAATATTTATTGG + Intronic
1005455797 6:26018578-26018600 TTTATTCAACAAATATTTATGGG + Intergenic
1005802201 6:29438425-29438447 TTTATTTGATAACTATTTATAGG - Intronic
1005930535 6:30480994-30481016 TGACTTCAGTGACTTTTTATTGG + Intergenic
1006270398 6:32961075-32961097 TTTATTTAGCAAATATTTATTGG + Intronic
1007538724 6:42621231-42621253 TTAATTGAATAACTATGTAGGGG - Intronic
1007563179 6:42827524-42827546 TTCATTCAATATGTATTTATTGG + Intronic
1007659683 6:43476127-43476149 TTCATTCAATAAATATTTACTGG + Intergenic
1007741104 6:44010012-44010034 TTAATTCACTCACCATTCATTGG - Intergenic
1007813748 6:44505370-44505392 ATCAGTCAATAACTATTTATTGG - Intergenic
1008028053 6:46660978-46661000 TTCAGTCAGTAGGTATTTATTGG + Intronic
1008464919 6:51819699-51819721 TTTATTCAGCAACTATTTACTGG - Intronic
1008869536 6:56256104-56256126 TTTGTTCAGCAACTATTTAATGG - Intronic
1008886410 6:56435948-56435970 TTTATTCAGCAAATATTTGTTGG + Intergenic
1009496327 6:64352950-64352972 TTCATTCAACAACTATTTGTTGG + Intronic
1009507086 6:64498226-64498248 ATAATTTAGTAACTCTCTATAGG - Intronic
1009530395 6:64805005-64805027 TTAATTCAGCAAATATTTTTTGG - Intronic
1009730818 6:67603628-67603650 TTAATTCTGTAAATATTTATTGG - Intergenic
1009759266 6:67982062-67982084 TTAATTCAGTAACTAATTAATGG + Intergenic
1010031651 6:71277448-71277470 TTAATTTAATAAATATATATTGG - Intergenic
1010470010 6:76216562-76216584 ATAATTCAATAAATATTTGTGGG - Intergenic
1010786403 6:80006001-80006023 TTAAGTTAGTAACTGTTTGTTGG + Intronic
1011376854 6:86696669-86696691 TTAATTCATTCAATATTTAATGG + Intergenic
1011579582 6:88844977-88844999 TTAATATACTTACTATTTATAGG + Intronic
1011631686 6:89332436-89332458 TTTATTCAACAATTATTTATTGG + Intronic
1011852155 6:91642930-91642952 TTAATCCATTAACTATTAAAGGG - Intergenic
1011994764 6:93571677-93571699 TTAAGTCAATAAGTATTTACTGG - Intergenic
1012113888 6:95269097-95269119 TTAATTCATTAAATAATTATAGG + Intergenic
1012218866 6:96623567-96623589 TTAATTCAGAAAGTATTTATTGG - Intergenic
1012425595 6:99110819-99110841 TCAGTTCAGAAAGTATTTATTGG - Intergenic
1012655404 6:101812307-101812329 TTTATTCAATAAATATTCATTGG + Intronic
1012866997 6:104630410-104630432 TTTATTCAATATTTATTTATGGG - Intergenic
1012949597 6:105503785-105503807 TTCCTTTAGTAAATATTTATTGG - Intergenic
1013046990 6:106496449-106496471 TTAATTCTGTTACGATTTCTAGG - Intergenic
1013371948 6:109478407-109478429 TTATTTCTGTAACCAGTTATAGG - Intronic
1013426713 6:110018829-110018851 TTCACTCAGTAACTAGTTATTGG + Intergenic
1013675553 6:112457648-112457670 ATAATTCAGTCATTATTGATTGG + Intergenic
1013859076 6:114611937-114611959 GTCATTCTGTAAGTATTTATTGG - Intergenic
1014286155 6:119501397-119501419 TTATTTCATGAACTATATATTGG - Intergenic
1014506249 6:122261654-122261676 TTTGTTCAGTATATATTTATGGG - Intergenic
1014715310 6:124857793-124857815 ATAATTCAAGAACTATTTCTGGG - Intergenic
1015108802 6:129568625-129568647 TTCATTCAACAAATATTTATTGG - Intergenic
1015210731 6:130695472-130695494 TTCATTCAACAAATATTTATTGG - Intergenic
1015335573 6:132033923-132033945 TTAATTCAACAAGTATATATTGG - Intergenic
1015436698 6:133197971-133197993 CTTATTCAGCAAGTATTTATTGG - Intergenic
1015686862 6:135873885-135873907 TTCATTCAACAAATATTTATTGG + Intronic
1016348707 6:143144262-143144284 TTAAATCAGTGATTATTTGTGGG + Intronic
1016432019 6:143995547-143995569 TTTATTCAACAAATATTTATAGG - Intronic
1016861344 6:148721700-148721722 TTCATTCACCAAATATTTATTGG + Intergenic
1016907340 6:149164685-149164707 TCAATTCAATAAATATTTATTGG - Intergenic
1017046737 6:150353570-150353592 TTAATTCAGTTACATCTTATGGG + Intergenic
1017208798 6:151832680-151832702 TTTATTCGGTAAGTATTTATTGG + Intronic
1017356027 6:153510276-153510298 TTAATTGACTATATATTTATGGG - Intergenic
1017392138 6:153952578-153952600 TTAATTCATTAATTTATTATTGG - Intergenic
1017537862 6:155367655-155367677 TTCATTCAGCGAATATTTATTGG + Intergenic
1017580833 6:155863498-155863520 TCAATTCTGGAACTATTTGTTGG - Intergenic
1018242240 6:161789160-161789182 TTAATCTAATAACTTTTTATTGG - Intronic
1018354880 6:163002577-163002599 TTTATTCAGTGACTACTTTTTGG - Intronic
1018432344 6:163732016-163732038 TTAACTCAGCAACTGTTTAGAGG - Intergenic
1018889469 6:167973184-167973206 TTAATTCAGCAGATGTTTATGGG + Intergenic
1019070100 6:169338404-169338426 TTATTTCAGTAACCAGTTACAGG + Intergenic
1020382607 7:7563520-7563542 TCAACTCAGTAAATATTTTTTGG + Intergenic
1020383330 7:7569396-7569418 TTTATTCTGTGACTATTGATTGG - Intronic
1020392515 7:7673832-7673854 TTCATTCAGCAAATATTTATTGG - Intronic
1020572120 7:9876960-9876982 TTCATTCAGCATATATTTATTGG - Intergenic
1021067936 7:16199295-16199317 TTTATTTAGTAACTACTGATAGG - Intronic
1021161355 7:17276980-17277002 TTTATTCAACAAATATTTATTGG + Intergenic
1021396439 7:20154602-20154624 CTAATTCAGTGGCTAATTATAGG + Intronic
1021740854 7:23683831-23683853 TTATTTCTGTAACTGGTTATAGG + Intronic
1021845546 7:24758930-24758952 TTAATTCAACAATTATTTACTGG - Intergenic
1021857927 7:24876124-24876146 TTAAGTCAACAACCATTTATGGG + Intronic
1022369325 7:29756081-29756103 TTAATTAATTGGCTATTTATTGG - Intergenic
1022400365 7:30030352-30030374 TTGATACAGTAACTATTTCCTGG + Intronic
1022636051 7:32136554-32136576 TTCTTTCAGCAAATATTTATTGG - Intronic
1022955684 7:35378031-35378053 TTTGTTCAGCAACTCTTTATTGG - Intergenic
1023093346 7:36636591-36636613 TTAATTCAGTGAATAATTAAGGG - Intronic
1023105856 7:36762667-36762689 TTTATTCAGTAATTACTGATGGG - Intergenic
1023264400 7:38391298-38391320 TTAATTTACCAAATATTTATGGG + Intronic
1023337511 7:39185729-39185751 ATCATTCAGTAAATATTTTTGGG + Intronic
1023575713 7:41624093-41624115 TTAATTCAACATATATTTATTGG - Intergenic
1024391576 7:48818979-48819001 GTAATTCAGCAGCTACTTATTGG - Intergenic
1024429896 7:49275576-49275598 TAAATTCAGAAACTATTCCTTGG - Intergenic
1024470173 7:49761188-49761210 GTAATTCAGTAATTTCTTATAGG + Intergenic
1024657432 7:51463443-51463465 TTCATTTAGGAAATATTTATTGG - Intergenic
1024816434 7:53276681-53276703 TTTATTCATTTACTTTTTATAGG + Intergenic
1026073496 7:67144096-67144118 TTAATTCAGTAGACATTTCTAGG + Intronic
1026703391 7:72668082-72668104 TTAATTCAGTAGACATTTCTAGG - Intronic
1027850350 7:83443828-83443850 TTAATGCAACAACTATTTAAGGG + Intronic
1028247114 7:88493026-88493048 TAAATTCAGTATTTATTTAATGG - Intergenic
1028846013 7:95480876-95480898 TTCATTCAATAAATATTTTTTGG - Intronic
1028915562 7:96255166-96255188 TTCATTCAGTATCTAATTGTTGG + Intronic
1028928890 7:96390988-96391010 TTTATTCAACAAATATTTATTGG - Intergenic
1029106617 7:98182184-98182206 TTTATTCAGCAGTTATTTATTGG + Intronic
1029613924 7:101644563-101644585 TAAAATCAGTAACTATCTATTGG + Intergenic
1029815778 7:103093151-103093173 TTACTTAAGAAACTTTTTATAGG - Intronic
1030288721 7:107851163-107851185 GTCATTCAATAACTATTTATTGG + Intergenic
1030581368 7:111359793-111359815 TTCATTCAATAAATATTTATTGG - Intronic
1030876202 7:114816556-114816578 TTAATTCAACAAATATTTAGTGG - Intergenic
1031158350 7:118136709-118136731 TTAATTTATTAAACATTTATTGG + Intergenic
1031269141 7:119623135-119623157 TTTATTCAACAAATATTTATAGG + Intergenic
1031373301 7:120994350-120994372 TTCATTTAGTAAATATTTATTGG + Intronic
1031716552 7:125115687-125115709 ATAATTTATTAACTATTTATTGG + Intergenic
1031744660 7:125478928-125478950 TTAATACATAAACTATTTATGGG - Intergenic
1032096884 7:128942803-128942825 TTAAATTAGTATATATTTATGGG + Intronic
1032635908 7:133708478-133708500 TTTATTCAATAAATATTTATTGG + Intronic
1032956193 7:136974269-136974291 GGCATTCAGTAAATATTTATAGG - Intronic
1033230594 7:139594385-139594407 TTAACACAGTCAGTATTTATTGG - Intronic
1033242965 7:139695938-139695960 TTAATTCAGGAAACATTTATTGG - Intronic
1033307547 7:140236070-140236092 TTCATCCAGTGAATATTTATTGG - Intergenic
1033949493 7:146766176-146766198 TTCATTCAATAAATATTTATTGG - Intronic
1035052629 7:156009565-156009587 TTAATTCTGTTACTCATTATAGG + Intergenic
1035143263 7:156785955-156785977 ATCATTCAGTTAATATTTATTGG - Intronic
1035814310 8:2522619-2522641 TTGATTCAATAAATGTTTATTGG + Intergenic
1036493100 8:9245907-9245929 TTCATTCAATGACTGTTTATTGG + Intergenic
1036695332 8:10970659-10970681 TTAATTCATTAAGCATTTATTGG + Intronic
1037003884 8:13752672-13752694 TAACTTGAGTAACTATATATTGG + Intergenic
1037267563 8:17082617-17082639 TTCATTCACTAACTACTTTTTGG - Intronic
1037423415 8:18728019-18728041 TTCATTCAGCAAATATTTAAGGG - Intronic
1037580527 8:20243331-20243353 TTTCTTCAATAAATATTTATTGG - Intergenic
1037995591 8:23350111-23350133 TCAGTTCAGTAACTATGTGTTGG - Intronic
1038022566 8:23562488-23562510 TTCATTCAACAAATATTTATTGG + Intronic
1038650026 8:29394184-29394206 TTCATTCAGCAAATATTTACTGG - Intergenic
1038836702 8:31133047-31133069 TAAATTCAGTTACTTTTTTTTGG + Intronic
1039130801 8:34262048-34262070 TTCTTTCAGTTATTATTTATTGG - Intergenic
1039394036 8:37207600-37207622 TTAATTCAGCAAACATTTGTTGG + Intergenic
1039399580 8:37257910-37257932 TTCATTCAACAACTATTTATTGG - Intergenic
1039782300 8:40797431-40797453 TTAATTCAGTAAGGATGTATTGG - Intronic
1040522528 8:48190699-48190721 TTCATTCAGCCAATATTTATTGG + Intergenic
1040688387 8:49905134-49905156 TTAATTTTGTAACTTCTTATTGG + Intergenic
1041003475 8:53475954-53475976 AGAATTCAGAAACTATTCATGGG + Intergenic
1041583304 8:59487263-59487285 TTAATTCAGAAACTCTGTCTAGG + Intergenic
1041596670 8:59662578-59662600 TTAATTCAGTAAATACTTACTGG + Intergenic
1042451165 8:68948736-68948758 TCTATTCAGCAAATATTTATTGG + Intergenic
1042502143 8:69521206-69521228 TTAATTTAATAAATATTTGTTGG + Intronic
1042569141 8:70143570-70143592 TTCCTTCAGCAAATATTTATTGG - Intronic
1042673256 8:71287347-71287369 TTAATTCAGTTAGTGTTTATTGG - Intronic
1042823429 8:72956434-72956456 TTCATTTAATAAATATTTATTGG - Intergenic
1042966175 8:74355274-74355296 TTCTTTAAGTAACCATTTATTGG + Intronic
1043254655 8:78119080-78119102 TAATCTCAGTAATTATTTATTGG - Intergenic
1043618953 8:82164134-82164156 TTTATTTAATAACTATTTATTGG + Intergenic
1043916234 8:85925751-85925773 TTTAGTCAGTAACTATGGATGGG - Intergenic
1043956023 8:86360631-86360653 CTCAGTCAGTAACTATTAATTGG + Intronic
1044089061 8:87976931-87976953 TTAATCCAGCATATATTTATTGG + Intergenic
1044153218 8:88808866-88808888 TTATTTCAACAAATATTTATCGG - Intergenic
1044338086 8:91013471-91013493 TTAATTCATTTAATATCTATTGG + Intronic
1044359670 8:91267426-91267448 TTAATTCCATTACTAATTATTGG + Intronic
1044367526 8:91366903-91366925 TTTATTCAGTATATATTTAATGG + Intronic
1044637866 8:94344744-94344766 TTTATTCAGTAAATATTATTAGG + Intergenic
1045215740 8:100146567-100146589 TTCATTCAATAAATATTTACTGG + Intergenic
1045332668 8:101169161-101169183 TTCATTCAGCAATGATTTATTGG + Intergenic
1045336722 8:101211209-101211231 TTCATTCAACAAATATTTATTGG - Intergenic
1045533761 8:103007966-103007988 TTCATTCAGTGAATATTTTTAGG - Intergenic
1045551430 8:103176280-103176302 TTAATTCAGCAAGTATGTACTGG + Intronic
1045720124 8:105099436-105099458 TTAATTCAGTAAATAATTCCTGG + Intronic
1045750364 8:105476702-105476724 TTTATTCAATAAATATTAATTGG - Intronic
1046054225 8:109060146-109060168 TTAATTCAACAAATATTTATTGG - Intergenic
1046096318 8:109566382-109566404 TTAACTCAGTGACTACTTTTGGG - Intergenic
1046275640 8:111956219-111956241 TTAATCCAGTTACTACTGATGGG + Intergenic
1046303193 8:112325588-112325610 GTCATTCAGCAAATATTTATTGG - Intronic
1046482409 8:114839498-114839520 TTCATTTATTAAATATTTATTGG - Intergenic
1046823241 8:118658765-118658787 TTAATTAATTCAATATTTATTGG + Intergenic
1046988831 8:120425626-120425648 TTAATTCACTCACTCATTATGGG + Intronic
1047516541 8:125559688-125559710 TTTATTCAATAGTTATTTATTGG + Intergenic
1047559862 8:125975099-125975121 TTCATTCAACAAATATTTATAGG - Intergenic
1047577214 8:126169934-126169956 TTCATTCAATAAATATGTATTGG - Intergenic
1048127073 8:131647695-131647717 TTAATTGAGAATCTCTTTATTGG + Intergenic
1048230132 8:132631099-132631121 TGGATTCAATAAATATTTATTGG + Intronic
1048268290 8:133006557-133006579 TTCATTCAACAACTATTTACGGG - Intronic
1050228326 9:3487460-3487482 TTAAGTCAGAAACTATTAGTTGG + Intronic
1050606349 9:7305357-7305379 TTAATTCAATAAATATGTATAGG - Intergenic
1050632038 9:7570050-7570072 TAAAATAAGTAACTAGTTATTGG + Intergenic
1050872793 9:10595014-10595036 TTATTCAAATAACTATTTATAGG + Intronic
1050983458 9:12050950-12050972 TTAATTGACTAAGTATTTGTAGG + Intergenic
1051028329 9:12641828-12641850 TGAGTTTAGTAAATATTTATGGG - Intergenic
1051029274 9:12655520-12655542 TAAAATCAATAAATATTTATTGG - Intergenic
1051059196 9:13026763-13026785 TTCACTCAATAAATATTTATTGG + Intergenic
1051180016 9:14401529-14401551 CTTGTTGAGTAACTATTTATAGG - Intergenic
1051330163 9:16016403-16016425 TTCATTCACTAAATATATATTGG - Intronic
1051745953 9:20294697-20294719 TTAATTCAATAAATATTTGCTGG + Intergenic
1051850088 9:21496183-21496205 TTTATTCATTCAATATTTATGGG - Intergenic
1052194092 9:25691389-25691411 TTTATTCAGTGAATATTTATTGG - Intergenic
1052278406 9:26704789-26704811 GTAATACAGAAGCTATTTATAGG - Intergenic
1052417275 9:28192342-28192364 TTAATTCAGTGAACATTTACTGG - Intronic
1053380676 9:37647603-37647625 TTCATTCAATAAATATTTATGGG + Intronic
1054919281 9:70525850-70525872 TCAATTCAGGAAATATTTCTTGG - Intergenic
1054969064 9:71063325-71063347 TGAAATCAGTAAATATTTATTGG + Intronic
1055040898 9:71870971-71870993 TTGACTCAATAAATATTTATTGG + Intronic
1055111954 9:72568465-72568487 TTTATTCAACAACTCTTTATGGG + Intronic
1055166279 9:73199284-73199306 TTAATTCAGAATATATTTTTTGG - Intergenic
1055189247 9:73497699-73497721 TTAATTCAATAATTATGTGTTGG + Intergenic
1055256597 9:74379092-74379114 TTATTTCAGAAAGTATTTAGAGG + Intergenic
1055373788 9:75627012-75627034 TTTATTCAGTAACTACTAACAGG + Intergenic
1055577462 9:77674616-77674638 TTTATTCAGTAACTAGTGAGTGG - Intergenic
1055634288 9:78259973-78259995 TTTATTCAGCAATTATTTATTGG + Intronic
1055687205 9:78788773-78788795 TTAAGTCAGTAGATATTTGTTGG + Intergenic
1055857847 9:80712907-80712929 TTAAATCACTAACTTTTTAAGGG - Intergenic
1055882621 9:81019783-81019805 TTAATTCAATAAATATTTACTGG - Intergenic
1055966151 9:81866972-81866994 TTAATTAACTAATTATTAATTGG + Intergenic
1056046191 9:82719651-82719673 TTAATTCAACAAATATTTATTGG + Intergenic
1056308844 9:85319718-85319740 TTAATTCTGTAACTGCTTACAGG + Intergenic
1056487234 9:87071680-87071702 TTCATTCAACAAATATTTATTGG + Intergenic
1056896625 9:90556797-90556819 TTAATTCAGTGAATAGTTATAGG - Intergenic
1057610022 9:96533699-96533721 TTTATTCATCAAATATTTATTGG - Intronic
1057779182 9:98035877-98035899 CTCATTCAGAAAATATTTATTGG + Intergenic
1057860740 9:98638986-98639008 TTATTTCTGTAACTGGTTATAGG - Intronic
1057990759 9:99767174-99767196 TTTATTTACTTACTATTTATAGG - Intergenic
1058066844 9:100558049-100558071 TTCATTCAGTATATGTTTATTGG + Intronic
1058111246 9:101032603-101032625 TTCATTCAACAAATATTTATTGG - Intronic
1058914782 9:109555251-109555273 TTTATTCATTCACTATTTATTGG - Intergenic
1059143058 9:111872592-111872614 GTAATTCAGTATTTATTTCTAGG - Intergenic
1059563077 9:115353914-115353936 TTATTTGAGTAAACATTTATTGG + Intronic
1059794763 9:117681720-117681742 TTTAGTCAGTATCGATTTATTGG + Intergenic
1059825306 9:118021662-118021684 TTTATTCAACAAATATTTATTGG - Intergenic
1059906864 9:118996681-118996703 GTCACTCAGTAAATATTTATTGG - Intergenic
1059941448 9:119363967-119363989 TTTATTCAACAAATATTTATTGG - Intronic
1060185150 9:121559669-121559691 TTTATTCAGTACATGTTTATTGG + Intergenic
1060271483 9:122145553-122145575 TAAATTCAGAAACCTTTTATTGG + Intronic
1060369120 9:123052472-123052494 TTTATTCAGTAAGTTTTTATCGG + Intronic
1060959724 9:127671512-127671534 GTAATTCAGTAAATTTTTGTTGG + Intronic
1061392155 9:130323199-130323221 TCTATTCAGCAAATATTTATGGG + Intronic
1061629820 9:131865047-131865069 TTTATTCAGCAAATATGTATTGG - Intronic
1061649764 9:132038136-132038158 TTCATTCAGCAAATATTTATGGG + Intronic
1185790595 X:2926008-2926030 TTAATTCTGTAACCAGTTACAGG + Intronic
1185889099 X:3808623-3808645 TTAATTCAGGAACCAAATATGGG - Intergenic
1186133706 X:6496535-6496557 TAAAGTCATTAACTATATATAGG + Intergenic
1186165994 X:6826670-6826692 CTAATTCAGCAACAAGTTATAGG + Intergenic
1186537579 X:10365695-10365717 TTAGTTCAGCAAACATTTATTGG + Intergenic
1186562708 X:10630077-10630099 TCATGTCAGTAAGTATTTATTGG + Intronic
1186669524 X:11755899-11755921 TTCATTCAGCAAATATTTATTGG - Intergenic
1186875564 X:13813470-13813492 TTATTTCAGCAACGATTCATAGG + Intronic
1187286337 X:17907594-17907616 TTAATTCAACAAGCATTTATTGG - Intergenic
1187405127 X:18996834-18996856 TTCACTCAGCAAATATTTATTGG - Intronic
1187462646 X:19501763-19501785 TTAAATCAATAATTATTTAAGGG + Intronic
1187997315 X:24942027-24942049 TTTATTCAGCAAATATGTATTGG + Intronic
1188023677 X:25186340-25186362 CTCATTCAGTAAATACTTATTGG - Intergenic
1188319057 X:28712641-28712663 TTAATCCAGTAGCGATGTATAGG + Intronic
1188406676 X:29819370-29819392 TTAAGTTAGTTTCTATTTATGGG - Intronic
1188464005 X:30457631-30457653 TTTATTCAACAGCTATTTATTGG + Intergenic
1188657154 X:32712145-32712167 TTTATTCTGTAACTATTTATTGG + Intronic
1189069090 X:37845847-37845869 TTTATCCACTAACTCTTTATAGG - Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189307186 X:39995642-39995664 TTCATTCAGTAAATATTTTTGGG - Intergenic
1189307196 X:39995741-39995763 TTCATTCAGTAAACATTTCTCGG + Intergenic
1189521396 X:41772623-41772645 TCAATTCCTTAAATATTTATAGG - Intronic
1189631207 X:42955366-42955388 CTAATGCAGTAACCTTTTATTGG + Intergenic
1189634912 X:42996854-42996876 TTCATTCAATACTTATTTATTGG - Intergenic
1189645706 X:43128773-43128795 TTGATCCAGTAATTTTTTATGGG - Intergenic
1189977037 X:46472122-46472144 CTAATGCAGGAACAATTTATAGG + Intronic
1190394922 X:49972219-49972241 ATAATTGAGTATGTATTTATTGG + Intronic
1191083095 X:56534851-56534873 TTCATTCAATAAATAGTTATTGG + Intergenic
1192024794 X:67438065-67438087 TTAATTCCACAAATATTTATTGG - Intergenic
1192301302 X:69905922-69905944 TTCAGTCAGTAAATATTTATTGG - Intronic
1192819452 X:74628968-74628990 TTAATACAGTATATATTTCTGGG + Intergenic
1193663496 X:84286490-84286512 TCAATTTTGTAACTTTTTATTGG + Intergenic
1193815013 X:86094719-86094741 TTAATTCAATAAATATTGGTTGG - Intergenic
1193824670 X:86208759-86208781 TTAATTGAGCAAGCATTTATTGG + Intronic
1194011037 X:88561452-88561474 TTTATTCAACCACTATTTATTGG - Intergenic
1194148860 X:90298295-90298317 TTAAATCATTAATTATTTCTTGG - Intergenic
1194321663 X:92455591-92455613 TTATTCCATTAATTATTTATAGG + Intronic
1194464991 X:94222665-94222687 ATCATTAAGTAACTATATATTGG + Intergenic
1194598174 X:95885761-95885783 TTAATGCAGTACCTATTTAAAGG + Intergenic
1194622621 X:96191853-96191875 TTCATTCAACAAATATTTATTGG + Intergenic
1194909903 X:99629390-99629412 TTAATTCACTAACACTTTGTTGG - Intergenic
1194975030 X:100385999-100386021 TTAATTCAACAAACATTTATTGG + Intronic
1195427505 X:104751225-104751247 TTTGTTCAGCAAATATTTATTGG + Intronic
1195615387 X:106907894-106907916 TTCATTCAATAAACATTTATGGG - Intronic
1196039810 X:111190002-111190024 TTCATTCAACAAATATTTATTGG + Intronic
1196085481 X:111679235-111679257 TTATTTCTGTAACTGTTTACAGG + Intronic
1196112183 X:111958476-111958498 ATAATTCAATACATATTTATTGG - Intronic
1196135109 X:112200454-112200476 TTCATTCAACAAATATTTATTGG - Intergenic
1196374544 X:115018675-115018697 TTAATTGAGTAGCTATTTGAAGG - Intronic
1196411306 X:115422502-115422524 AAAATTCAATAAATATTTATTGG + Intergenic
1196776988 X:119347458-119347480 TTCATTCAGCAGATATTTATTGG + Intergenic
1197151534 X:123225345-123225367 TTTATTCAGTAATCATTTATTGG - Intronic
1197173093 X:123456152-123456174 TTCATTCAATATATATTTATGGG + Intronic
1197292855 X:124681479-124681501 TTAATGCAGTAATTATTTGTTGG + Intronic
1197433627 X:126398208-126398230 TTAATTTAGTAATTGTTGATTGG + Intergenic
1197454607 X:126663184-126663206 TTTATTCAGAAAATATTAATTGG - Intergenic
1197969266 X:132097903-132097925 TTGATTCAGTAAATATTTGTTGG + Intronic
1198061888 X:133054233-133054255 TTAATTCTTTAACTATAGATGGG + Intronic
1199149288 X:144410774-144410796 TTAATTCAGTAGCTCTAGATTGG + Intergenic
1199189814 X:144957308-144957330 TTAATTTTGTTACTAGTTATTGG - Intergenic
1199191179 X:144972957-144972979 TTAATTCAACAAATATTTATTGG - Intergenic
1199213333 X:145239703-145239725 CTCATTCAATAAATATTTATTGG + Intergenic
1199417880 X:147607431-147607453 TTAATTCACTAAAAATTTTTAGG + Intergenic
1199769762 X:150967492-150967514 TTCATTCAGCAACTATTCACTGG + Intergenic
1199822798 X:151466093-151466115 TTATTTCAGTATTGATTTATAGG + Intergenic
1200412188 Y:2871928-2871950 TTAATTCTGTGAATAGTTATGGG + Intronic
1200495228 Y:3875024-3875046 TTAAATCATTAATTATTTCTTGG - Intergenic
1200629835 Y:5569070-5569092 TTATTCCATTAATTATTTATAGG + Intronic
1200947233 Y:8855844-8855866 ATACTTCTGTAACTATTTATTGG + Intergenic
1201181993 Y:11357772-11357794 CTGATTCAGTTACTAGTTATAGG - Intergenic
1201464200 Y:14262278-14262300 TTAATTCAACAAATATTTACTGG - Intergenic
1202194197 Y:22279625-22279647 TTGTTTCAGTCACCATTTATTGG + Intergenic