ID: 936766155

View in Genome Browser
Species Human (GRCh38)
Location 2:115851034-115851056
Sequence GAGAGATGGCAATTGAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936766155_936766157 20 Left 936766155 2:115851034-115851056 CCAGCTTTCAATTGCCATCTCTC No data
Right 936766157 2:115851077-115851099 CTGTTTGTAGTCTATTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936766155 Original CRISPR GAGAGATGGCAATTGAAAGC TGG (reversed) Intergenic
No off target data available for this crispr