ID: 936781931

View in Genome Browser
Species Human (GRCh38)
Location 2:116043782-116043804
Sequence GACTCAGATGTACAACAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936781930_936781931 -7 Left 936781930 2:116043766-116043788 CCTAAAAAGAGTTTCTGACTCAG No data
Right 936781931 2:116043782-116043804 GACTCAGATGTACAACAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936781931 Original CRISPR GACTCAGATGTACAACAGTT AGG Intergenic
No off target data available for this crispr