ID: 936785849

View in Genome Browser
Species Human (GRCh38)
Location 2:116094001-116094023
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936785846_936785849 -5 Left 936785846 2:116093983-116094005 CCTAGGTGGTTTATTCAGGCACT No data
Right 936785849 2:116094001-116094023 GCACTGGTGTTAGCAGGTCCAGG No data
936785842_936785849 18 Left 936785842 2:116093960-116093982 CCAAATATTTATTTTTCTGGGCA No data
Right 936785849 2:116094001-116094023 GCACTGGTGTTAGCAGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type