ID: 936792428

View in Genome Browser
Species Human (GRCh38)
Location 2:116165364-116165386
Sequence TACATGGAGGTACAGGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936792428_936792437 27 Left 936792428 2:116165364-116165386 CCCAATACCTGTACCTCCATGTA No data
Right 936792437 2:116165414-116165436 TTTGACAGGCTTAGAGGTGGAGG No data
936792428_936792439 29 Left 936792428 2:116165364-116165386 CCCAATACCTGTACCTCCATGTA No data
Right 936792439 2:116165416-116165438 TGACAGGCTTAGAGGTGGAGGGG No data
936792428_936792434 13 Left 936792428 2:116165364-116165386 CCCAATACCTGTACCTCCATGTA No data
Right 936792434 2:116165400-116165422 TAGCTTGCTTTTGATTTGACAGG No data
936792428_936792438 28 Left 936792428 2:116165364-116165386 CCCAATACCTGTACCTCCATGTA No data
Right 936792438 2:116165415-116165437 TTGACAGGCTTAGAGGTGGAGGG No data
936792428_936792436 24 Left 936792428 2:116165364-116165386 CCCAATACCTGTACCTCCATGTA No data
Right 936792436 2:116165411-116165433 TGATTTGACAGGCTTAGAGGTGG No data
936792428_936792435 21 Left 936792428 2:116165364-116165386 CCCAATACCTGTACCTCCATGTA No data
Right 936792435 2:116165408-116165430 TTTTGATTTGACAGGCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936792428 Original CRISPR TACATGGAGGTACAGGTATT GGG (reversed) Intergenic
No off target data available for this crispr