ID: 936792429

View in Genome Browser
Species Human (GRCh38)
Location 2:116165365-116165387
Sequence ATACATGGAGGTACAGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936792429_936792436 23 Left 936792429 2:116165365-116165387 CCAATACCTGTACCTCCATGTAT No data
Right 936792436 2:116165411-116165433 TGATTTGACAGGCTTAGAGGTGG No data
936792429_936792434 12 Left 936792429 2:116165365-116165387 CCAATACCTGTACCTCCATGTAT No data
Right 936792434 2:116165400-116165422 TAGCTTGCTTTTGATTTGACAGG No data
936792429_936792437 26 Left 936792429 2:116165365-116165387 CCAATACCTGTACCTCCATGTAT No data
Right 936792437 2:116165414-116165436 TTTGACAGGCTTAGAGGTGGAGG No data
936792429_936792438 27 Left 936792429 2:116165365-116165387 CCAATACCTGTACCTCCATGTAT No data
Right 936792438 2:116165415-116165437 TTGACAGGCTTAGAGGTGGAGGG No data
936792429_936792435 20 Left 936792429 2:116165365-116165387 CCAATACCTGTACCTCCATGTAT No data
Right 936792435 2:116165408-116165430 TTTTGATTTGACAGGCTTAGAGG No data
936792429_936792439 28 Left 936792429 2:116165365-116165387 CCAATACCTGTACCTCCATGTAT No data
Right 936792439 2:116165416-116165438 TGACAGGCTTAGAGGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936792429 Original CRISPR ATACATGGAGGTACAGGTAT TGG (reversed) Intergenic