ID: 936792431

View in Genome Browser
Species Human (GRCh38)
Location 2:116165371-116165393
Sequence TCCTAGATACATGGAGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936792431_936792436 17 Left 936792431 2:116165371-116165393 CCTGTACCTCCATGTATCTAGGA No data
Right 936792436 2:116165411-116165433 TGATTTGACAGGCTTAGAGGTGG No data
936792431_936792437 20 Left 936792431 2:116165371-116165393 CCTGTACCTCCATGTATCTAGGA No data
Right 936792437 2:116165414-116165436 TTTGACAGGCTTAGAGGTGGAGG No data
936792431_936792434 6 Left 936792431 2:116165371-116165393 CCTGTACCTCCATGTATCTAGGA No data
Right 936792434 2:116165400-116165422 TAGCTTGCTTTTGATTTGACAGG No data
936792431_936792435 14 Left 936792431 2:116165371-116165393 CCTGTACCTCCATGTATCTAGGA No data
Right 936792435 2:116165408-116165430 TTTTGATTTGACAGGCTTAGAGG No data
936792431_936792439 22 Left 936792431 2:116165371-116165393 CCTGTACCTCCATGTATCTAGGA No data
Right 936792439 2:116165416-116165438 TGACAGGCTTAGAGGTGGAGGGG No data
936792431_936792438 21 Left 936792431 2:116165371-116165393 CCTGTACCTCCATGTATCTAGGA No data
Right 936792438 2:116165415-116165437 TTGACAGGCTTAGAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936792431 Original CRISPR TCCTAGATACATGGAGGTAC AGG (reversed) Intergenic
No off target data available for this crispr