ID: 936792432

View in Genome Browser
Species Human (GRCh38)
Location 2:116165377-116165399
Sequence GTTACTTCCTAGATACATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936792432_936792439 16 Left 936792432 2:116165377-116165399 CCTCCATGTATCTAGGAAGTAAC No data
Right 936792439 2:116165416-116165438 TGACAGGCTTAGAGGTGGAGGGG No data
936792432_936792438 15 Left 936792432 2:116165377-116165399 CCTCCATGTATCTAGGAAGTAAC No data
Right 936792438 2:116165415-116165437 TTGACAGGCTTAGAGGTGGAGGG No data
936792432_936792434 0 Left 936792432 2:116165377-116165399 CCTCCATGTATCTAGGAAGTAAC No data
Right 936792434 2:116165400-116165422 TAGCTTGCTTTTGATTTGACAGG No data
936792432_936792435 8 Left 936792432 2:116165377-116165399 CCTCCATGTATCTAGGAAGTAAC No data
Right 936792435 2:116165408-116165430 TTTTGATTTGACAGGCTTAGAGG No data
936792432_936792436 11 Left 936792432 2:116165377-116165399 CCTCCATGTATCTAGGAAGTAAC No data
Right 936792436 2:116165411-116165433 TGATTTGACAGGCTTAGAGGTGG No data
936792432_936792437 14 Left 936792432 2:116165377-116165399 CCTCCATGTATCTAGGAAGTAAC No data
Right 936792437 2:116165414-116165436 TTTGACAGGCTTAGAGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936792432 Original CRISPR GTTACTTCCTAGATACATGG AGG (reversed) Intergenic
No off target data available for this crispr