ID: 936792433

View in Genome Browser
Species Human (GRCh38)
Location 2:116165380-116165402
Sequence CTAGTTACTTCCTAGATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936792433_936792439 13 Left 936792433 2:116165380-116165402 CCATGTATCTAGGAAGTAACTAG No data
Right 936792439 2:116165416-116165438 TGACAGGCTTAGAGGTGGAGGGG No data
936792433_936792437 11 Left 936792433 2:116165380-116165402 CCATGTATCTAGGAAGTAACTAG No data
Right 936792437 2:116165414-116165436 TTTGACAGGCTTAGAGGTGGAGG No data
936792433_936792438 12 Left 936792433 2:116165380-116165402 CCATGTATCTAGGAAGTAACTAG No data
Right 936792438 2:116165415-116165437 TTGACAGGCTTAGAGGTGGAGGG No data
936792433_936792435 5 Left 936792433 2:116165380-116165402 CCATGTATCTAGGAAGTAACTAG No data
Right 936792435 2:116165408-116165430 TTTTGATTTGACAGGCTTAGAGG No data
936792433_936792434 -3 Left 936792433 2:116165380-116165402 CCATGTATCTAGGAAGTAACTAG No data
Right 936792434 2:116165400-116165422 TAGCTTGCTTTTGATTTGACAGG No data
936792433_936792436 8 Left 936792433 2:116165380-116165402 CCATGTATCTAGGAAGTAACTAG No data
Right 936792436 2:116165411-116165433 TGATTTGACAGGCTTAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936792433 Original CRISPR CTAGTTACTTCCTAGATACA TGG (reversed) Intergenic