ID: 936792434

View in Genome Browser
Species Human (GRCh38)
Location 2:116165400-116165422
Sequence TAGCTTGCTTTTGATTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936792428_936792434 13 Left 936792428 2:116165364-116165386 CCCAATACCTGTACCTCCATGTA No data
Right 936792434 2:116165400-116165422 TAGCTTGCTTTTGATTTGACAGG No data
936792429_936792434 12 Left 936792429 2:116165365-116165387 CCAATACCTGTACCTCCATGTAT No data
Right 936792434 2:116165400-116165422 TAGCTTGCTTTTGATTTGACAGG No data
936792433_936792434 -3 Left 936792433 2:116165380-116165402 CCATGTATCTAGGAAGTAACTAG No data
Right 936792434 2:116165400-116165422 TAGCTTGCTTTTGATTTGACAGG No data
936792431_936792434 6 Left 936792431 2:116165371-116165393 CCTGTACCTCCATGTATCTAGGA No data
Right 936792434 2:116165400-116165422 TAGCTTGCTTTTGATTTGACAGG No data
936792432_936792434 0 Left 936792432 2:116165377-116165399 CCTCCATGTATCTAGGAAGTAAC No data
Right 936792434 2:116165400-116165422 TAGCTTGCTTTTGATTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936792434 Original CRISPR TAGCTTGCTTTTGATTTGAC AGG Intergenic
No off target data available for this crispr