ID: 936802819

View in Genome Browser
Species Human (GRCh38)
Location 2:116287731-116287753
Sequence CTCCTCACTGCTGAGAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936802815_936802819 -7 Left 936802815 2:116287715-116287737 CCGCTGAAGCCTAGACCTCCTCA No data
Right 936802819 2:116287731-116287753 CTCCTCACTGCTGAGAGAGGAGG No data
936802812_936802819 30 Left 936802812 2:116287678-116287700 CCCAAATAGACTCTTTGACAGCA 0: 5
1: 152
2: 82
3: 41
4: 174
Right 936802819 2:116287731-116287753 CTCCTCACTGCTGAGAGAGGAGG No data
936802813_936802819 29 Left 936802813 2:116287679-116287701 CCAAATAGACTCTTTGACAGCAG No data
Right 936802819 2:116287731-116287753 CTCCTCACTGCTGAGAGAGGAGG No data
936802814_936802819 -1 Left 936802814 2:116287709-116287731 CCAAAACCGCTGAAGCCTAGACC No data
Right 936802819 2:116287731-116287753 CTCCTCACTGCTGAGAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936802819 Original CRISPR CTCCTCACTGCTGAGAGAGG AGG Intergenic
No off target data available for this crispr