ID: 936813894

View in Genome Browser
Species Human (GRCh38)
Location 2:116435762-116435784
Sequence GACTCACAGTACCACAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936813894_936813898 16 Left 936813894 2:116435762-116435784 CCAGTCCTGTGGTACTGTGAGTC No data
Right 936813898 2:116435801-116435823 TTTACAAATTACCCCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936813894 Original CRISPR GACTCACAGTACCACAGGAC TGG (reversed) Intergenic
No off target data available for this crispr