ID: 936819008

View in Genome Browser
Species Human (GRCh38)
Location 2:116496309-116496331
Sequence CTGATAACTCAGATATTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936819004_936819008 7 Left 936819004 2:116496279-116496301 CCTGTTTGAAAGTTGGCCCTCAG No data
Right 936819008 2:116496309-116496331 CTGATAACTCAGATATTAAAAGG No data
936819007_936819008 -10 Left 936819007 2:116496296-116496318 CCTCAGCTGGCATCTGATAACTC No data
Right 936819008 2:116496309-116496331 CTGATAACTCAGATATTAAAAGG No data
936819002_936819008 29 Left 936819002 2:116496257-116496279 CCTGAAACTAAATGCACAAAGAC No data
Right 936819008 2:116496309-116496331 CTGATAACTCAGATATTAAAAGG No data
936819006_936819008 -9 Left 936819006 2:116496295-116496317 CCCTCAGCTGGCATCTGATAACT No data
Right 936819008 2:116496309-116496331 CTGATAACTCAGATATTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936819008 Original CRISPR CTGATAACTCAGATATTAAA AGG Intergenic
No off target data available for this crispr