ID: 936824276

View in Genome Browser
Species Human (GRCh38)
Location 2:116561859-116561881
Sequence GGATCCTCAAAAAAGCTATT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936824276 Original CRISPR GGATCCTCAAAAAAGCTATT CGG Intergenic