ID: 936833522

View in Genome Browser
Species Human (GRCh38)
Location 2:116678911-116678933
Sequence CAGCTCCAGCAGTTGTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936833517_936833522 28 Left 936833517 2:116678860-116678882 CCTACCCGCTCGCATCCACACTT No data
Right 936833522 2:116678911-116678933 CAGCTCCAGCAGTTGTTGTGAGG No data
936833519_936833522 23 Left 936833519 2:116678865-116678887 CCGCTCGCATCCACACTTGAAAC No data
Right 936833522 2:116678911-116678933 CAGCTCCAGCAGTTGTTGTGAGG No data
936833518_936833522 24 Left 936833518 2:116678864-116678886 CCCGCTCGCATCCACACTTGAAA No data
Right 936833522 2:116678911-116678933 CAGCTCCAGCAGTTGTTGTGAGG No data
936833520_936833522 13 Left 936833520 2:116678875-116678897 CCACACTTGAAACATTTTCAGAT No data
Right 936833522 2:116678911-116678933 CAGCTCCAGCAGTTGTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936833522 Original CRISPR CAGCTCCAGCAGTTGTTGTG AGG Intergenic
No off target data available for this crispr