ID: 936834030

View in Genome Browser
Species Human (GRCh38)
Location 2:116684907-116684929
Sequence CTGTTAGGAATCAGAATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936834030_936834034 19 Left 936834030 2:116684907-116684929 CCCAAAATTCTGATTCCTAACAG No data
Right 936834034 2:116684949-116684971 GCAAGCACTCAAATGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936834030 Original CRISPR CTGTTAGGAATCAGAATTTT GGG (reversed) Intergenic
No off target data available for this crispr