ID: 936844566

View in Genome Browser
Species Human (GRCh38)
Location 2:116815547-116815569
Sequence CTGTGCAAACAGATGCCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936844566_936844567 -2 Left 936844566 2:116815547-116815569 CCATAGGGCATCTGTTTGCACAG No data
Right 936844567 2:116815568-116815590 AGTCCTTTTAAATTCTAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936844566 Original CRISPR CTGTGCAAACAGATGCCCTA TGG (reversed) Intergenic
No off target data available for this crispr