ID: 936846985

View in Genome Browser
Species Human (GRCh38)
Location 2:116847781-116847803
Sequence AGATGAGTGTTACAATACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936846985_936846986 1 Left 936846985 2:116847781-116847803 CCTGTGTATTGTAACACTCATCT No data
Right 936846986 2:116847805-116847827 ATTAATTTGATTTAGATCACAGG No data
936846985_936846987 16 Left 936846985 2:116847781-116847803 CCTGTGTATTGTAACACTCATCT No data
Right 936846987 2:116847820-116847842 ATCACAGGCCCAAATACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936846985 Original CRISPR AGATGAGTGTTACAATACAC AGG (reversed) Intergenic
No off target data available for this crispr