ID: 936848746

View in Genome Browser
Species Human (GRCh38)
Location 2:116870869-116870891
Sequence CAATATTAGAACAATGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936848746_936848751 16 Left 936848746 2:116870869-116870891 CCTGTCTCATTGTTCTAATATTG No data
Right 936848751 2:116870908-116870930 GTCTCTCACTATTATTGTGTGGG 0: 72
1: 1366
2: 5081
3: 5062
4: 1916
936848746_936848750 15 Left 936848746 2:116870869-116870891 CCTGTCTCATTGTTCTAATATTG No data
Right 936848750 2:116870907-116870929 AGTCTCTCACTATTATTGTGTGG 0: 79
1: 1466
2: 5297
3: 5356
4: 1924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936848746 Original CRISPR CAATATTAGAACAATGAGAC AGG (reversed) Intergenic
No off target data available for this crispr