ID: 936850889

View in Genome Browser
Species Human (GRCh38)
Location 2:116896334-116896356
Sequence AAAAATGCTGATAGTGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936850889_936850890 4 Left 936850889 2:116896334-116896356 CCTATATCACTATCAGCATTTTT No data
Right 936850890 2:116896361-116896383 CTACCATTCAACAAGTCTCTAGG 0: 3
1: 68
2: 550
3: 2172
4: 2104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936850889 Original CRISPR AAAAATGCTGATAGTGATAT AGG (reversed) Intergenic
No off target data available for this crispr