ID: 936851981

View in Genome Browser
Species Human (GRCh38)
Location 2:116910932-116910954
Sequence GGTCATCTGGTCTTACCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936851977_936851981 5 Left 936851977 2:116910904-116910926 CCATCTCAGTGTCTATCTCTTGG No data
Right 936851981 2:116910932-116910954 GGTCATCTGGTCTTACCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936851981 Original CRISPR GGTCATCTGGTCTTACCTAC TGG Intergenic
No off target data available for this crispr