ID: 936855377

View in Genome Browser
Species Human (GRCh38)
Location 2:116951958-116951980
Sequence TAGCTGCTATAGAGGAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936855374_936855377 -1 Left 936855374 2:116951936-116951958 CCAGCGAACATGAGATCAGCAGT No data
Right 936855377 2:116951958-116951980 TAGCTGCTATAGAGGAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936855377 Original CRISPR TAGCTGCTATAGAGGAGAAA GGG Intergenic
No off target data available for this crispr