ID: 936856395

View in Genome Browser
Species Human (GRCh38)
Location 2:116963145-116963167
Sequence GGGTATAAATAGTTGGATTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936856391_936856395 4 Left 936856391 2:116963118-116963140 CCACTATATTGGCTGTGGCTATC No data
Right 936856395 2:116963145-116963167 GGGTATAAATAGTTGGATTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936856395 Original CRISPR GGGTATAAATAGTTGGATTA CGG Intergenic
No off target data available for this crispr