ID: 936856475

View in Genome Browser
Species Human (GRCh38)
Location 2:116964347-116964369
Sequence GGCCAAAGGCTGCCATTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936856475_936856480 5 Left 936856475 2:116964347-116964369 CCCATCAATGGCAGCCTTTGGCC No data
Right 936856480 2:116964375-116964397 TCACCTGTCTCAGCTTTGTAAGG No data
936856475_936856482 27 Left 936856475 2:116964347-116964369 CCCATCAATGGCAGCCTTTGGCC No data
Right 936856482 2:116964397-116964419 GATCATACATAGACCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936856475 Original CRISPR GGCCAAAGGCTGCCATTGAT GGG (reversed) Intergenic
No off target data available for this crispr