ID: 936858971

View in Genome Browser
Species Human (GRCh38)
Location 2:116993363-116993385
Sequence ACAGTTGGATAGTGTTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936858969_936858971 20 Left 936858969 2:116993320-116993342 CCTTCTCAAAATTGGGGTTATCA No data
Right 936858971 2:116993363-116993385 ACAGTTGGATAGTGTTACCCTGG No data
936858965_936858971 29 Left 936858965 2:116993311-116993333 CCAGTGTTTCCTTCTCAAAATTG No data
Right 936858971 2:116993363-116993385 ACAGTTGGATAGTGTTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936858971 Original CRISPR ACAGTTGGATAGTGTTACCC TGG Intergenic
No off target data available for this crispr