ID: 936861467

View in Genome Browser
Species Human (GRCh38)
Location 2:117025548-117025570
Sequence ATCCTATCCATTATAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936861462_936861467 10 Left 936861462 2:117025515-117025537 CCTATCAACACGAACATCCTCCT No data
Right 936861467 2:117025548-117025570 ATCCTATCCATTATAGTGGGTGG No data
936861463_936861467 -7 Left 936861463 2:117025532-117025554 CCTCCTGTTGATCACAATCCTAT No data
Right 936861467 2:117025548-117025570 ATCCTATCCATTATAGTGGGTGG No data
936861464_936861467 -10 Left 936861464 2:117025535-117025557 CCTGTTGATCACAATCCTATCCA No data
Right 936861467 2:117025548-117025570 ATCCTATCCATTATAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936861467 Original CRISPR ATCCTATCCATTATAGTGGG TGG Intergenic
No off target data available for this crispr