ID: 936863951

View in Genome Browser
Species Human (GRCh38)
Location 2:117055998-117056020
Sequence AACGACGCGGGGATTGACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936863951_936863956 -9 Left 936863951 2:117055998-117056020 CCTCGGTCAATCCCCGCGTCGTT No data
Right 936863956 2:117056012-117056034 CGCGTCGTTCCACCGGTCGATGG No data
936863951_936863959 9 Left 936863951 2:117055998-117056020 CCTCGGTCAATCCCCGCGTCGTT No data
Right 936863959 2:117056030-117056052 GATGGCCTGCCGCAGTCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936863951 Original CRISPR AACGACGCGGGGATTGACCG AGG (reversed) Intergenic