ID: 936863951 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:117055998-117056020 |
| Sequence | AACGACGCGGGGATTGACCG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 936863951_936863956 | -9 | Left | 936863951 | 2:117055998-117056020 | CCTCGGTCAATCCCCGCGTCGTT | No data | ||
| Right | 936863956 | 2:117056012-117056034 | CGCGTCGTTCCACCGGTCGATGG | No data | ||||
| 936863951_936863959 | 9 | Left | 936863951 | 2:117055998-117056020 | CCTCGGTCAATCCCCGCGTCGTT | No data | ||
| Right | 936863959 | 2:117056030-117056052 | GATGGCCTGCCGCAGTCTGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 936863951 | Original CRISPR | AACGACGCGGGGATTGACCG AGG (reversed) | Intergenic | ||