ID: 936866807

View in Genome Browser
Species Human (GRCh38)
Location 2:117084308-117084330
Sequence ACCTTCTAGCAACTAGACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936866807_936866808 -1 Left 936866807 2:117084308-117084330 CCTTAGTCTAGTTGCTAGAAGGT No data
Right 936866808 2:117084330-117084352 TTGATTATCATGTTTACCTGTGG No data
936866807_936866809 10 Left 936866807 2:117084308-117084330 CCTTAGTCTAGTTGCTAGAAGGT No data
Right 936866809 2:117084341-117084363 GTTTACCTGTGGAATAGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936866807 Original CRISPR ACCTTCTAGCAACTAGACTA AGG (reversed) Intergenic
No off target data available for this crispr