ID: 936867117

View in Genome Browser
Species Human (GRCh38)
Location 2:117087527-117087549
Sequence TTGGGGAGTCAGCATGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936867117_936867129 18 Left 936867117 2:117087527-117087549 CCCTCATCATGCTGACTCCCCAA No data
Right 936867129 2:117087568-117087590 GAGCAGGAGCACTGTCATCTGGG 0: 11
1: 36
2: 80
3: 129
4: 363
936867117_936867126 2 Left 936867117 2:117087527-117087549 CCCTCATCATGCTGACTCCCCAA No data
Right 936867126 2:117087552-117087574 CTCCTGGGCTGTGACAGAGCAGG No data
936867117_936867128 17 Left 936867117 2:117087527-117087549 CCCTCATCATGCTGACTCCCCAA No data
Right 936867128 2:117087567-117087589 AGAGCAGGAGCACTGTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936867117 Original CRISPR TTGGGGAGTCAGCATGATGA GGG (reversed) Intergenic
No off target data available for this crispr