ID: 936868889

View in Genome Browser
Species Human (GRCh38)
Location 2:117109655-117109677
Sequence CGGCAAACAGCAGTGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936868889_936868893 13 Left 936868889 2:117109655-117109677 CCATCCAACACTGCTGTTTGCCG No data
Right 936868893 2:117109691-117109713 GCCACTGATTTCCATCCCTCAGG No data
936868889_936868895 19 Left 936868889 2:117109655-117109677 CCATCCAACACTGCTGTTTGCCG No data
Right 936868895 2:117109697-117109719 GATTTCCATCCCTCAGGATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936868889 Original CRISPR CGGCAAACAGCAGTGTTGGA TGG (reversed) Intergenic
No off target data available for this crispr