ID: 936869185

View in Genome Browser
Species Human (GRCh38)
Location 2:117112393-117112415
Sequence CAATATCCAAAGCAGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936869185_936869191 29 Left 936869185 2:117112393-117112415 CCATGCTCCTGCTTTGGATATTG No data
Right 936869191 2:117112445-117112467 ATAGCCAGTAACACTCAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936869185 Original CRISPR CAATATCCAAAGCAGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr