ID: 936869381

View in Genome Browser
Species Human (GRCh38)
Location 2:117116252-117116274
Sequence GATGATTTCCAGAAATTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936869381_936869383 -4 Left 936869381 2:117116252-117116274 CCATCCAATTTCTGGAAATCATC No data
Right 936869383 2:117116271-117116293 CATCACAACTCTCAATAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936869381 Original CRISPR GATGATTTCCAGAAATTGGA TGG (reversed) Intergenic
No off target data available for this crispr