ID: 936877314

View in Genome Browser
Species Human (GRCh38)
Location 2:117206434-117206456
Sequence AAATATAGGCAGAAATTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936877312_936877314 -5 Left 936877312 2:117206416-117206438 CCGTGGATTGTTGCAAAGAAATA No data
Right 936877314 2:117206434-117206456 AAATATAGGCAGAAATTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936877314 Original CRISPR AAATATAGGCAGAAATTGAA TGG Intergenic
No off target data available for this crispr