ID: 936884552

View in Genome Browser
Species Human (GRCh38)
Location 2:117294528-117294550
Sequence CTTTCTATAAAGGTGGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936884552_936884559 9 Left 936884552 2:117294528-117294550 CCTAGATCCACCTTTATAGAAAG No data
Right 936884559 2:117294560-117294582 TCAACTGAAGGAAATGCAGTTGG No data
936884552_936884558 -3 Left 936884552 2:117294528-117294550 CCTAGATCCACCTTTATAGAAAG No data
Right 936884558 2:117294548-117294570 AAGTGGGGCTGCTCAACTGAAGG No data
936884552_936884560 26 Left 936884552 2:117294528-117294550 CCTAGATCCACCTTTATAGAAAG No data
Right 936884560 2:117294577-117294599 AGTTGGCAATCTCCAGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936884552 Original CRISPR CTTTCTATAAAGGTGGATCT AGG (reversed) Intergenic
No off target data available for this crispr