ID: 936886961

View in Genome Browser
Species Human (GRCh38)
Location 2:117322049-117322071
Sequence CTATCAATGCTGAGAGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936886959_936886961 18 Left 936886959 2:117322008-117322030 CCTAAAACACAAACAGGGCATCA No data
Right 936886961 2:117322049-117322071 CTATCAATGCTGAGAGTGAGAGG No data
936886958_936886961 19 Left 936886958 2:117322007-117322029 CCCTAAAACACAAACAGGGCATC No data
Right 936886961 2:117322049-117322071 CTATCAATGCTGAGAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936886961 Original CRISPR CTATCAATGCTGAGAGTGAG AGG Intergenic
No off target data available for this crispr