ID: 936900314

View in Genome Browser
Species Human (GRCh38)
Location 2:117474504-117474526
Sequence CTCCCGTGAGGCAGGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936900314_936900320 2 Left 936900314 2:117474504-117474526 CCACCAGGCCTGCCTCACGGGAG No data
Right 936900320 2:117474529-117474551 CCTGAAGGAAGCACTAAATATGG 0: 1048
1: 5770
2: 3765
3: 1309
4: 689
936900314_936900321 7 Left 936900314 2:117474504-117474526 CCACCAGGCCTGCCTCACGGGAG No data
Right 936900321 2:117474534-117474556 AGGAAGCACTAAATATGGAAAGG 0: 969
1: 5603
2: 3687
3: 1295
4: 710

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936900314 Original CRISPR CTCCCGTGAGGCAGGCCTGG TGG (reversed) Intergenic
No off target data available for this crispr